ID: 1113835916

View in Genome Browser
Species Human (GRCh38)
Location 13:113328359-113328381
Sequence CAGGCGTCTGCACATGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 193}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113835912_1113835916 -3 Left 1113835912 13:113328339-113328361 CCATACAAAGACGGTGGCCACAG 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1113835916 13:113328359-113328381 CAGGCGTCTGCACATGGCTGTGG 0: 1
1: 0
2: 2
3: 23
4: 193
1113835904_1113835916 29 Left 1113835904 13:113328307-113328329 CCTCAGGGTCTGCGGTCAGACGT 0: 1
1: 0
2: 0
3: 6
4: 58
Right 1113835916 13:113328359-113328381 CAGGCGTCTGCACATGGCTGTGG 0: 1
1: 0
2: 2
3: 23
4: 193
1113835903_1113835916 30 Left 1113835903 13:113328306-113328328 CCCTCAGGGTCTGCGGTCAGACG 0: 1
1: 0
2: 0
3: 10
4: 79
Right 1113835916 13:113328359-113328381 CAGGCGTCTGCACATGGCTGTGG 0: 1
1: 0
2: 2
3: 23
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113835916 Original CRISPR CAGGCGTCTGCACATGGCTG TGG Intronic
900177407 1:1297058-1297080 CAGGCGTGTGCACGTGTGTGGGG + Intronic
900211967 1:1460579-1460601 CAGGCGGGTGACCATGGCTGTGG + Intronic
900330521 1:2132216-2132238 TGGGCCACTGCACATGGCTGAGG + Intronic
900620033 1:3582486-3582508 GAGGCGTCTGCAGAGGGCAGGGG - Intronic
901527854 1:9835473-9835495 CAGGCATCTGGAGATGCCTGGGG - Intergenic
902155731 1:14484684-14484706 AAGGCGCATTCACATGGCTGCGG + Intergenic
902564007 1:17298014-17298036 CAGGCGTCTTCAGCTGCCTGTGG - Intergenic
903822069 1:26111014-26111036 GAGGCGCCTGCACCTGGCTGCGG - Intergenic
904098754 1:28003689-28003711 CATGCCACTGCACCTGGCTGGGG + Intronic
907718794 1:56952365-56952387 CAAGCCTCTTCACATGGCTGGGG - Intronic
912470009 1:109900395-109900417 CAGGCCTCTGCACCAGGATGGGG - Intergenic
916558524 1:165913032-165913054 CAGGCGTCTCCTCCTAGCTGTGG - Intergenic
916696633 1:167244221-167244243 CAGGCATCTGGGCATGGCTCAGG + Intronic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
918238839 1:182604245-182604267 CAGGGTGCGGCACATGGCTGCGG + Exonic
921182785 1:212644699-212644721 CAGGCATTTGGATATGGCTGAGG - Intergenic
921291744 1:213664039-213664061 GCGGCATCTGCACATGGGTGAGG - Intergenic
921340767 1:214132155-214132177 AAGGCTTCTGAACATTGCTGGGG - Intergenic
924511865 1:244734436-244734458 CAGGCTCCTACACATGCCTGGGG + Intergenic
924584496 1:245350180-245350202 CAGAGGTGTGCACAGGGCTGAGG + Intronic
1062923039 10:1294273-1294295 CAGCCATGTGCAGATGGCTGAGG + Intronic
1063670387 10:8095399-8095421 GCAGTGTCTGCACATGGCTGTGG + Intergenic
1067155123 10:43775159-43775181 AAGGCGTTTGTACATGGCAGTGG + Intergenic
1070095434 10:73333147-73333169 CAGTTGACTGGACATGGCTGAGG + Intronic
1072057455 10:91774252-91774274 CTGGCAGTTGCACATGGCTGAGG - Intergenic
1072253016 10:93596527-93596549 CTGGAGTCTGGAAATGGCTGGGG - Intronic
1072800935 10:98391932-98391954 CATGCGTCTGCAGTTGGCTGTGG - Intronic
1076664598 10:132079080-132079102 CAGGCCTCGGCAGCTGGCTGTGG - Intergenic
1076716342 10:132366143-132366165 CAGTCCTCTCCACATGTCTGTGG + Intronic
1076905873 10:133360740-133360762 CTGGCGTCTGCACTGAGCTGGGG + Intergenic
1077322406 11:1948168-1948190 GAGGCCCCTGCACATAGCTGGGG + Intronic
1077443292 11:2578600-2578622 CAGGGGCCTCCTCATGGCTGGGG + Intronic
1077924472 11:6667125-6667147 CAGTAGACTGGACATGGCTGAGG - Intergenic
1078592323 11:12653988-12654010 CAGGGGTCTCCACATACCTGTGG - Intergenic
1079999770 11:27334076-27334098 CAGGCCACTGCACCTGGCTCTGG + Intronic
1081835635 11:46151255-46151277 CAGACGTCTGGGCATGGCTTAGG + Intergenic
1082768587 11:57187898-57187920 AGGGTGTCTGCACATGGCAGAGG + Exonic
1083683001 11:64359810-64359832 CAGAGGTGTGCACCTGGCTGGGG - Intronic
1083893557 11:65608891-65608913 CAGGCCACTGCACCTGGCCGAGG + Intronic
1084793679 11:71490568-71490590 CAGTCGTCTGAACAGAGCTGAGG - Intronic
1085428513 11:76426159-76426181 GAGACGTCTGCAGAAGGCTGTGG - Intergenic
1087059348 11:93962832-93962854 CAGACATTTGCACAGGGCTGGGG - Intergenic
1088998861 11:115031789-115031811 CAGTAGACTGGACATGGCTGAGG + Intergenic
1089916873 11:122165376-122165398 TACGCTTCTGCACATGGATGGGG - Intergenic
1090503093 11:127281066-127281088 CAGGAGTATTCACATGTCTGGGG + Intergenic
1090645678 11:128765032-128765054 CAGGTGTGTGCACAGGGCCGGGG + Intronic
1090788476 11:130070003-130070025 CAGGAGCCTGCCCGTGGCTGCGG - Exonic
1202805424 11_KI270721v1_random:3481-3503 GAGGCCCCTGCACATAGCTGGGG + Intergenic
1091637077 12:2205286-2205308 CAGGTGTCCACACTTGGCTGTGG + Intronic
1092249329 12:6883917-6883939 CAGGTGAGTGCACATGGCTGTGG + Intronic
1093711360 12:22333780-22333802 CAGGTGTCTGCACATCTCTGGGG + Intronic
1095710656 12:45284614-45284636 CAGATGCCTGCAAATGGCTGGGG - Intronic
1101729132 12:107412328-107412350 CAGGCGTCTGAGCTTGGCTCAGG - Intronic
1101729299 12:107413402-107413424 CAGGCGTCTGAACTTAGCTCAGG - Intronic
1101895576 12:108754075-108754097 CAGGCGGCTGGAGATGGCAGAGG - Intergenic
1101978948 12:109388706-109388728 CATCCGTCTGCACATGGAAGGGG + Exonic
1104174724 12:126319278-126319300 CAGGCGTCTGCACCGTGCTTAGG + Intergenic
1104368743 12:128203085-128203107 CAGGTGTGAGCACATGGCTCAGG + Intergenic
1105247581 13:18666829-18666851 CACCCCTCTGCACATGGCTGTGG + Intergenic
1113366610 13:109682480-109682502 CCAGCCTCTGCACAAGGCTGTGG - Intergenic
1113711093 13:112466145-112466167 CATGTGTGTGCACATGGATGGGG - Intergenic
1113800941 13:113085917-113085939 CAAGGGTCTGCACCTGGCAGGGG + Intronic
1113835916 13:113328359-113328381 CAGGCGTCTGCACATGGCTGTGG + Intronic
1114065007 14:19053265-19053287 CAGCCACCTGCACATGGCGGGGG - Intergenic
1114097254 14:19346737-19346759 CAGCCACCTGCACATGGCGGGGG + Intergenic
1115831696 14:37349838-37349860 CAGGCAGCTGTATATGGCTGCGG - Intronic
1116391188 14:44391781-44391803 CTGGCCTCTCCACATGGCTTGGG - Intergenic
1117737721 14:58784619-58784641 CAAGTAACTGCACATGGCTGGGG - Intergenic
1118485581 14:66211635-66211657 CAGGCCTCTGCAACTGGCTGTGG + Intergenic
1118810784 14:69271508-69271530 CTGGCATCTGCCCAAGGCTGGGG + Intronic
1122082514 14:99275107-99275129 CAGGGGTGGGTACATGGCTGTGG - Intergenic
1122262786 14:100532650-100532672 CAGGCCTCAGCACATGTTTGTGG + Intergenic
1122893157 14:104742281-104742303 AAGGCGTCCGCACTTGCCTGTGG - Intronic
1124610051 15:31201915-31201937 CATGGCTCTGCTCATGGCTGTGG - Intergenic
1125957314 15:43799403-43799425 CAGGCGGCTGCAAGTGGATGCGG + Exonic
1127292006 15:57579540-57579562 AAGGCGTCTGGGCATGGCGGAGG + Intergenic
1128341891 15:66827975-66827997 CACCTGTCTGTACATGGCTGTGG - Intergenic
1129086708 15:73101558-73101580 CAGGCCTCAGCACATGGTGGGGG - Intronic
1130059834 15:80561315-80561337 CTGGGGTCTGCACATGCCTGTGG + Intronic
1133646904 16:7773243-7773265 GAGACATCTTCACATGGCTGGGG + Intergenic
1135266434 16:21030355-21030377 CAGGCCACTTCACATGGCTTGGG - Intronic
1136012027 16:27369999-27370021 CAGGGGTCAGCATGTGGCTGGGG - Intergenic
1136394102 16:29983547-29983569 CAGGCGGCTGGAGAGGGCTGGGG - Exonic
1138548153 16:57731613-57731635 CAGTTGTTTGCAGATGGCTGTGG - Intronic
1142074175 16:88107915-88107937 CAGGCGCCTGGTAATGGCTGAGG + Intronic
1142425967 16:90002427-90002449 CAGACGGCTGCACGTGCCTGGGG + Intergenic
1142700681 17:1658476-1658498 CGGGACTCTGTACATGGCTGTGG - Intronic
1143918398 17:10311820-10311842 GAGGTGTCTGGAGATGGCTGTGG + Intronic
1144468287 17:15514890-15514912 CAGGGAAGTGCACATGGCTGTGG + Intronic
1145000182 17:19299444-19299466 CAGGGGTCTCATCATGGCTGGGG - Intronic
1145237847 17:21221665-21221687 CTGGCCTCTCCACATGGCTTGGG - Intergenic
1148442385 17:47718113-47718135 TACGCGTCTGCATATGGGTGTGG - Intergenic
1148769975 17:50061020-50061042 CAGAGGCCTGCACATGGATGGGG - Intronic
1150610972 17:66732835-66732857 CAGTCGTCTGCAAATTGCAGGGG + Intronic
1150865907 17:68849757-68849779 GAGGGGTCTACACATGGCAGAGG + Intergenic
1151289170 17:73136483-73136505 CATGCACCTGCACATGGCTTTGG - Intergenic
1152511180 17:80790086-80790108 GAGGTGTCTGGGCATGGCTGAGG + Intronic
1152668159 17:81583841-81583863 TAGGCATTTGCACATGGATGTGG - Intronic
1154441261 18:14392293-14392315 CACCCCTCTGCACATGGCTGTGG - Intergenic
1157332401 18:46713431-46713453 CAGTCAGATGCACATGGCTGAGG + Intronic
1161361142 19:3850394-3850416 CAGGTGGCTCCTCATGGCTGAGG - Intronic
1161531690 19:4793462-4793484 CACCCCTCTGCACATGGCTGTGG + Exonic
1161713904 19:5864973-5864995 CAGTGGTGTGCACTTGGCTGGGG - Intergenic
1161714135 19:5866073-5866095 CAGTGGTGTGCACATGGCTGGGG - Exonic
1161768852 19:6220761-6220783 CAAGCGCCTGCCCAGGGCTGTGG + Intronic
1162874405 19:13610141-13610163 CAGGCGCAGGCACCTGGCTGGGG - Intronic
1162959251 19:14116776-14116798 CAAGCGTCTGTCCCTGGCTGGGG - Intronic
1164580449 19:29431915-29431937 CAGGCTGGTGAACATGGCTGTGG - Intergenic
1164720135 19:30425894-30425916 CAGGCATCTGTAGTTGGCTGTGG + Intronic
1164833920 19:31344793-31344815 AAGGCGACTGCTCAGGGCTGTGG - Intronic
1165305535 19:35000596-35000618 GGGGCCTCTGCACATGGCTCTGG + Intronic
1166678974 19:44756229-44756251 CAGGCCTCTCCATATTGCTGTGG + Exonic
1167853864 19:52222149-52222171 CACGGTTCTGCGCATGGCTGGGG + Exonic
924994372 2:343531-343553 CAGGCGTGTGAACATGCATGCGG + Intergenic
924995084 2:352708-352730 GAGGCGTGTGCACATCTCTGTGG + Intergenic
925160340 2:1678851-1678873 CAGGCGGCTGCACAGGGGTCTGG + Intronic
925826407 2:7852408-7852430 AAGGCATCTGCACGGGGCTGGGG + Intergenic
926727375 2:16009063-16009085 CAGGCCCCTCCACATTGCTGTGG - Intergenic
927212959 2:20649917-20649939 CATCCATCTGCACATGGCTGAGG + Intronic
927487064 2:23495740-23495762 CAGGCTCCGGCTCATGGCTGTGG + Intronic
932489827 2:72113627-72113649 CAGGCCTCAGCACCAGGCTGAGG - Intergenic
933770691 2:85742069-85742091 CTGGCGTGTGCACATGCCTGTGG - Intergenic
934902869 2:98174689-98174711 CAGGCACATGCACAGGGCTGTGG + Intronic
937477476 2:122228183-122228205 CATGCTTCTGCCCAGGGCTGAGG - Intergenic
938573172 2:132581299-132581321 CAGGAGTCTTCACAGGGCTATGG + Intronic
940070338 2:149679436-149679458 CAGGCATCTCCTCATAGCTGTGG - Intergenic
944547772 2:200814537-200814559 CAGGTATGTGCACAAGGCTGTGG + Intronic
946518022 2:220434485-220434507 CAGGTTTCTGAGCATGGCTGAGG - Intergenic
948204931 2:236158660-236158682 GAGGCGTCTGCTCCTGGCAGAGG - Intergenic
948226905 2:236318311-236318333 CAGGCCTCTTCCCAGGGCTGCGG - Intergenic
948229753 2:236341393-236341415 CAGGCGTCTGCAGGGGGCAGGGG + Intronic
948519042 2:238524032-238524054 CAGGCCTCTGACCATGGCCGTGG - Intergenic
948717416 2:239874328-239874350 GAGGCAGCTGCACACGGCTGTGG - Intergenic
1169794530 20:9447440-9447462 CAGGCTTGTTCACATGGCTGGGG + Intronic
1173192331 20:40886182-40886204 CAGGTGCCTGCCCATGGCTAGGG + Intergenic
1174396300 20:50248647-50248669 TCAGAGTCTGCACATGGCTGAGG - Intergenic
1175284703 20:57830313-57830335 CAGCCAACTGCACATGGCTGGGG + Intergenic
1175893110 20:62323985-62324007 CAGGCCTCTGCAGAGGGCAGTGG + Intronic
1175947666 20:62566270-62566292 CAGTCTTCAGCACAGGGCTGGGG + Intronic
1176454798 21:6898882-6898904 CACGCCTCTGCACATGGCTGTGG + Intergenic
1176832971 21:13763930-13763952 CACGCCTCTGCACATGGCTGTGG + Intergenic
1179627775 21:42658264-42658286 CAGGCCTCTGCACCCTGCTGGGG + Intronic
1180483496 22:15775885-15775907 CAGCCACCTGCACATGGCGGGGG - Intergenic
1180756339 22:18164521-18164543 CAGGAGTCTGGACAGGCCTGTGG - Intronic
1181075431 22:20372913-20372935 CAGGAGTCTGGACAGGCCTGTGG + Intronic
1184949414 22:47829702-47829724 GAGGCGGCTCCCCATGGCTGGGG - Intergenic
952897651 3:38088861-38088883 CAGTGGTCTGCCCCTGGCTGTGG + Intronic
953227536 3:41034206-41034228 CAGGTGACTGAGCATGGCTGGGG + Intergenic
954380314 3:50215734-50215756 CAGGTAGCTGGACATGGCTGTGG - Exonic
959378042 3:105608852-105608874 CAGGGGCCTGGACATTGCTGCGG + Intergenic
961331852 3:126147233-126147255 CAGGCCTCTAGGCATGGCTGGGG + Intronic
962008440 3:131370748-131370770 TAGGTGTCTGGAGATGGCTGAGG + Intergenic
962825930 3:139101048-139101070 CAGCCCTCTGCACATGGACGTGG + Intronic
962919236 3:139935841-139935863 CAGGTGTCTGCTCCTGCCTGGGG + Intronic
963398248 3:144760823-144760845 CAGGAGTCTGGGCATGGCTTTGG + Intergenic
966526907 3:180929615-180929637 CATTTGTCTGCACATGGCAGGGG - Intronic
968552529 4:1231056-1231078 CAGGAATCTGAACATGGCTGGGG + Intronic
969860643 4:10033033-10033055 GAGGAGTCTGCACATAGGTGGGG - Intronic
970714382 4:18904701-18904723 CTGGAGTCTGCACAGGTCTGGGG - Intergenic
973535979 4:51882421-51882443 CATGCCTCTGCACATGGCTTGGG - Intronic
976988266 4:91329022-91329044 CTGACATCTCCACATGGCTGAGG - Intronic
978827116 4:113038782-113038804 AAGGCCTCTCCACATGGCTTGGG - Intronic
986374196 5:7113686-7113708 CAGGTATCTGCAAGTGGCTGAGG - Intergenic
987077701 5:14399597-14399619 CAGCTGTCTCCACATAGCTGGGG - Intronic
987571407 5:19666207-19666229 CAGGCGTGGGGACATGACTGTGG - Intronic
988517338 5:31916379-31916401 CAGGCCTCTACACCTGACTGTGG - Intronic
988919176 5:35925096-35925118 CAGGCGTCTGCACATTCCCCCGG + Intronic
989556941 5:42808339-42808361 CAGGCTTCTCCACATTGCTGGGG + Exonic
990993909 5:61712154-61712176 AAGGATTCTGCTCATGGCTGTGG - Intronic
994271842 5:97786857-97786879 CAGGCGCATGAAAATGGCTGGGG - Intergenic
995934109 5:117487371-117487393 CAGGAGTCTGCACTTGCCTGGGG - Intergenic
998149195 5:139747392-139747414 CAGGCCTCTGCGGATGGCAGAGG + Intergenic
998911180 5:146962119-146962141 TCTGAGTCTGCACATGGCTGGGG + Intronic
1001716605 5:173821550-173821572 CAGGCGTCTGCTGAGGGATGAGG - Intergenic
1002185807 5:177454378-177454400 CAGGCGTCTGTACAGGGCGTCGG + Intronic
1005916947 6:30360555-30360577 CAGGCTTCTGCTCTTGTCTGGGG + Intergenic
1012717965 6:102701250-102701272 CAGGCGTCTACATCTGGATGAGG + Intergenic
1013667708 6:112365794-112365816 CACCCCTCTGCACATGGCTGTGG - Intergenic
1015103398 6:129507515-129507537 CAGGAATCTCCACATGGCAGAGG + Exonic
1018082489 6:160270502-160270524 GAGACATATGCACATGGCTGTGG + Intronic
1018370720 6:163165532-163165554 CAGGGGTCTCCACAGGGGTGGGG - Intronic
1019032086 6:169022563-169022585 CAGATGTCTGCACAAGCCTGGGG - Intergenic
1019550228 7:1598576-1598598 CAGACGTGTGCACAGGGGTGTGG + Intergenic
1019663000 7:2235809-2235831 CACAGGTCTGCCCATGGCTGAGG - Intronic
1023367865 7:39482687-39482709 CAGTAGACTGGACATGGCTGAGG - Intronic
1024058498 7:45681720-45681742 GAGGCCTGTGCAAATGGCTGTGG + Intronic
1024236215 7:47401070-47401092 CAGGCGCCTGCAGACAGCTGGGG + Intronic
1026765473 7:73156980-73157002 CAGGGGGCTGCCCAGGGCTGAGG - Intergenic
1027041947 7:74966674-74966696 CAGGGGGCTGCCCAGGGCTGAGG - Intronic
1027081695 7:75235681-75235703 CAGGGGGCTGCCCAGGGCTGAGG + Intergenic
1029390282 7:100270262-100270284 CAGGGGGCTGCCCAGGGCTGAGG + Intronic
1035081803 7:156222383-156222405 CAGGCTTGTGCACCTGGCTGGGG + Intergenic
1035111559 7:156486590-156486612 CATGGGTCTGCACACAGCTGGGG - Intergenic
1040440648 8:47438109-47438131 CAGGCAGCTGAGCATGGCTGGGG + Intronic
1040821869 8:51568861-51568883 CAGTCGACTGGATATGGCTGAGG - Intronic
1042092327 8:65172421-65172443 AGGGCCTCTGCACATGGCTTGGG + Intergenic
1042298632 8:67250892-67250914 CAGGCTTCTGAATATGCCTGGGG - Intronic
1047509882 8:125507903-125507925 GAGGCCTTTGCACAGGGCTGAGG + Intergenic
1049517177 8:143066524-143066546 GAATCGGCTGCACATGGCTGTGG + Intergenic
1051121513 9:13757115-13757137 CTGACGTCTGTATATGGCTGAGG - Intergenic
1051721744 9:20044481-20044503 CAGGGTTGTGCTCATGGCTGTGG + Intergenic
1052517466 9:29501907-29501929 CAGGATTCTGCTCATGTCTGAGG + Intergenic
1053417155 9:37953916-37953938 CATGCCTCTGGACTTGGCTGGGG + Intronic
1056593894 9:87989325-87989347 CAGGCCACTGCACCTGGCTGAGG + Intergenic
1060182560 9:121544573-121544595 CAGGCAGGTGCACCTGGCTGAGG - Intergenic
1060820324 9:126658141-126658163 CTGACCTCTGCACTTGGCTGGGG - Intronic
1061008994 9:127944326-127944348 CAGGGCTCAGCACATGGCAGGGG - Intronic
1062041583 9:134406842-134406864 CAGACGTCTGCAGAGGGGTGCGG - Intronic
1062120906 9:134833642-134833664 CAGGGCTGTGCAGATGGCTGGGG - Intronic
1062401979 9:136376746-136376768 CAGGAGGCTGTACATGGATGGGG + Intronic
1203792829 EBV:160806-160828 CCGGAGTCTGGACGTGGCTGCGG - Intergenic
1186503118 X:10067964-10067986 CAGGGGGCTTGACATGGCTGAGG - Intronic
1186865520 X:13717271-13717293 CAGGCGACTGCTCACAGCTGGGG - Intronic
1188086802 X:25908893-25908915 CAGGAGTCTGCAAATGGCAGTGG - Intergenic
1188768499 X:34125813-34125835 CAGCAGTCTGCTCAAGGCTGGGG + Intergenic
1194796314 X:98215239-98215261 CAGGCTTCTTCACATAGCAGTGG + Intergenic
1198041820 X:132860091-132860113 CAGGCATCTGCGCATGTGTGGGG + Intronic
1199558022 X:149130351-149130373 CAGTTGTCTGCAAATGTCTGTGG - Intergenic
1200110330 X:153737622-153737644 CAGGGGTTTGGACAGGGCTGGGG + Intronic