ID: 1113836465

View in Genome Browser
Species Human (GRCh38)
Location 13:113331311-113331333
Sequence ACCTGGGGGTTGGGGGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 584
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 522}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113836454_1113836465 0 Left 1113836454 13:113331288-113331310 CCATGGCAGAGACCAGGTGCATG 0: 1
1: 0
2: 1
3: 19
4: 251
Right 1113836465 13:113331311-113331333 ACCTGGGGGTTGGGGGCTCAGGG 0: 1
1: 0
2: 4
3: 57
4: 522
1113836452_1113836465 12 Left 1113836452 13:113331276-113331298 CCACAGGATTGACCATGGCAGAG 0: 1
1: 0
2: 0
3: 10
4: 166
Right 1113836465 13:113331311-113331333 ACCTGGGGGTTGGGGGCTCAGGG 0: 1
1: 0
2: 4
3: 57
4: 522
1113836450_1113836465 23 Left 1113836450 13:113331265-113331287 CCTCATCTGAGCCACAGGATTGA 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1113836465 13:113331311-113331333 ACCTGGGGGTTGGGGGCTCAGGG 0: 1
1: 0
2: 4
3: 57
4: 522

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113836465 Original CRISPR ACCTGGGGGTTGGGGGCTCA GGG Intronic
900175048 1:1287883-1287905 ACCTGGGCTTTGGGGGGTGAGGG + Intronic
900698316 1:4026874-4026896 AGCTGGGCTTTGGGAGCTCATGG + Intergenic
901499313 1:9641737-9641759 ACCTGGGGATGGAGGGCACAAGG + Intergenic
901815127 1:11789395-11789417 ACCGCGGGGTTGGGGGCTTGGGG + Exonic
902335757 1:15753731-15753753 CCCAGTGGGATGGGGGCTCAAGG + Intergenic
902456873 1:16539614-16539636 AACTGGAGGTTGGGAGTTCAGGG + Intergenic
902472214 1:16656953-16656975 ATCTGGGGATTGGGAGCTGATGG + Intergenic
902486589 1:16750493-16750515 ATCTGGGGATTGGGAGCTGATGG - Intronic
902495296 1:16868299-16868321 AACTGGAGGTTGGGAGTTCAGGG - Intronic
902536962 1:17124825-17124847 GCCTGGGGGTTGGGGACCCCTGG + Intergenic
902719594 1:18295274-18295296 ACCTGGGAGTTCTGGGCTCTGGG - Intronic
903276047 1:22222552-22222574 ACCTGAGGGTGGGGATCTCATGG + Intergenic
903461544 1:23524422-23524444 CCTTGGGGGTTGGGAACTCAGGG + Exonic
903822367 1:26112101-26112123 TCCTCGGGGCTGGGGGCTGAGGG - Intronic
905231795 1:36519054-36519076 TGTTTGGGGTTGGGGGCTCAGGG + Intergenic
906202784 1:43970736-43970758 GCCTGGGGATCCGGGGCTCATGG + Intronic
906259639 1:44377358-44377380 ACCTGGTGGGTGAGGGCACAGGG - Intergenic
906717427 1:47980466-47980488 CCATGGGGGTGGGGGACTCAGGG + Intronic
906952586 1:50346934-50346956 ATCTGGGGGTTGGGCGCACTGGG - Intergenic
907029845 1:51160281-51160303 GCCTGGGGGTTGGGGACTCTTGG - Intergenic
907038404 1:51236566-51236588 CCCCCGGGGTTGGGGGATCAAGG - Exonic
907359941 1:53906301-53906323 ACCTGGGGACAGGGGGCCCAGGG + Intronic
907487806 1:54789284-54789306 AGCTGGGGGATGTGGGCTTAAGG + Intronic
908355974 1:63324635-63324657 AGGTAGGCGTTGGGGGCTCAGGG - Exonic
909082497 1:71129809-71129831 ACCTGGAGCTTGGGGCTTCAAGG - Intergenic
909195419 1:72615472-72615494 AACTGGGGGTTGAGGGGTGATGG + Intergenic
911433842 1:97829893-97829915 GTCTGGGGGTGGGGGGCTGAGGG - Intronic
912005932 1:104901778-104901800 ACATGGGGGTAGGGGGCACATGG + Intergenic
912063949 1:105712231-105712253 GCCTGGGGGTTGGGGACCCCTGG - Intergenic
913239939 1:116821293-116821315 ACCTGGGGACTGGGGGCCCCTGG - Intergenic
915626054 1:157114790-157114812 CACTAGGGGTTGGGGGCTCTTGG + Intergenic
916068226 1:161153476-161153498 GCCTTGGGGTTGGGGGCTCGGGG + Intronic
916942594 1:169691576-169691598 ACCTGTGGGCTGGGGGTTGAGGG + Exonic
917077645 1:171221918-171221940 TCCTGGGGCTTGAGGCCTCATGG - Intergenic
917348130 1:174049937-174049959 GCCTGGGGGTTGGGGACCCCTGG - Intergenic
917441948 1:175076156-175076178 AGATGGGGGTTGGGGGCACAAGG + Intronic
917442642 1:175080625-175080647 ACCTGCTAGATGGGGGCTCATGG + Intronic
918782711 1:188723251-188723273 ACCTGGCGGATGGGGGTTGAGGG - Intergenic
919624432 1:199897513-199897535 ATCTGGGGGTTGGGAGGTGATGG - Intergenic
919756267 1:201067999-201068021 TCCTGGGGGTGGTGGGCTCTGGG - Intronic
919758942 1:201084907-201084929 AGCTGGGGGTTGGGGGTTCCTGG + Intronic
920039412 1:203085818-203085840 CCCTGGGGCCTCGGGGCTCAGGG + Exonic
920069976 1:203295933-203295955 ACCTGGGGGATGGGGGCTGAAGG - Intergenic
920085332 1:203411403-203411425 GCCTGGGGGTTGGGGACCCCTGG + Intergenic
920417008 1:205805661-205805683 ACCTTGGTGTGAGGGGCTCATGG + Intronic
920499043 1:206474762-206474784 ACCTGGAGAATGGGGGCTCTGGG + Intronic
921165588 1:212504540-212504562 AGCTGTGGGTTGGTTGCTCATGG - Intergenic
921299230 1:213734806-213734828 ACCTGGGCATTGGCGGCACAAGG + Intergenic
921350833 1:214232802-214232824 ACTTGGGGAGTGGGTGCTCATGG - Intergenic
922471451 1:225879724-225879746 CCCTGGAGGTTGTGGGCTCACGG + Intronic
1062861389 10:813042-813064 ACTTGAGGGCTGGGGGCTCCCGG + Exonic
1064046168 10:12017888-12017910 ATCTGGGGGTTGGAGGGCCAGGG - Intronic
1065469066 10:26057885-26057907 ACCTGGGGGAAGGGGACACATGG - Intronic
1066291487 10:34018271-34018293 CTCTGGGTGTTGGGGCCTCAGGG - Intergenic
1066677894 10:37907831-37907853 ACCTGGGAGTTGGGGACCCCTGG - Intergenic
1067428712 10:46228144-46228166 CTCTGGGGGTTGGGTTCTCAGGG - Intergenic
1069568467 10:69479516-69479538 GGCTGGGGGTGGGGGGCACACGG - Intronic
1070161941 10:73872227-73872249 ACCTGAGGCTTGGAGGGTCAGGG - Intronic
1070769080 10:79071769-79071791 ACGTGTGAGTTGGGGGCCCAGGG + Intronic
1070777388 10:79117830-79117852 ACCTGGGGGCCTGAGGCTCAGGG - Intronic
1071918647 10:90325117-90325139 ATTTGGGGGTGGGGGGCACAGGG - Intergenic
1072298738 10:94038473-94038495 GCCTTGGGGTTAGGGGTTCAGGG - Intronic
1072519165 10:96215015-96215037 AACTGTGGGTTGAGGGCTGAGGG + Intronic
1072721976 10:97786797-97786819 ACCTGGCCGTTCGGGGCTCCTGG + Intergenic
1072795129 10:98348830-98348852 ACCTGGGGGTCTTGGCCTCACGG - Intergenic
1073057128 10:100710065-100710087 TCCTGGGGGATGGGGGCGCGGGG - Intergenic
1073652282 10:105374306-105374328 GTCTGGGGGTGGGGGGCTAAGGG - Intergenic
1074221043 10:111438270-111438292 CCCTGGAGATTGGTGGCTCAGGG - Intergenic
1074978422 10:118599620-118599642 ACCTGGGGTTTTTGGCCTCACGG + Intergenic
1075040785 10:119104901-119104923 TGGTGGGGGTTGGGGGCTCTGGG - Intronic
1075744477 10:124717110-124717132 ACTTAGGGGATGGGGGCTCTGGG + Intronic
1076131372 10:128016358-128016380 ACCTGGGGGCTGGGGGTGCCTGG - Intronic
1076273174 10:129174521-129174543 GCCTGGGGGTTGGGGGGACAGGG - Intergenic
1076482143 10:130791978-130792000 AACTGGGTGATGGGGGCTCGGGG - Intergenic
1076573934 10:131451621-131451643 ACCTGGGTGTTTGGGGCTCAGGG + Intergenic
1076755780 10:132570954-132570976 TCCTGGTGGGTGGGGGCTGAGGG + Intronic
1076786117 10:132750960-132750982 TCGTGGGGTTTGGGGGCTTATGG + Intronic
1076910245 10:133384334-133384356 ACCTGGTGGGGGGGCGCTCATGG - Intronic
1077246819 11:1543786-1543808 CCCTGGGGGTCAGGGCCTCAAGG - Intergenic
1077426457 11:2481491-2481513 GCCTGGGGGTTGGGGACGCCTGG - Intronic
1077886554 11:6391634-6391656 ACCTGGGGCTGGGGGGCTAGGGG - Exonic
1078492846 11:11785473-11785495 GCCTGGGGGTTGGGGACCCCTGG - Intergenic
1079959234 11:26902138-26902160 GCCAGGGGGTTGGGGGCTTGGGG + Intergenic
1080171467 11:29308028-29308050 GACTGGTGGTTGGGGGCTCTTGG - Intergenic
1082171133 11:49007208-49007230 ATCTGGGGGTTGGGGGATAGGGG - Intergenic
1083149534 11:60783352-60783374 ATCTGGGGGTTGTGGGATCTGGG + Intergenic
1083149601 11:60783576-60783598 ATCTGGGGGTTGTGGGATCTGGG + Intergenic
1083279718 11:61619371-61619393 TCCTGGGGGTGGAGGCCTCAGGG + Intergenic
1083707799 11:64528798-64528820 GCCTGGGAGTTGGAGGCTGATGG - Intergenic
1083778658 11:64906872-64906894 CTCTGGGGGTTGGCGGCTCCTGG + Intronic
1083956633 11:65987523-65987545 GCCGGGGGGTACGGGGCTCAGGG - Intergenic
1083994688 11:66266197-66266219 ACCTGGGGTTAGGGGGCTCCTGG - Exonic
1084010425 11:66345328-66345350 AGCTGGGGGTGGGGGGATCGGGG - Intergenic
1084553415 11:69862497-69862519 ACCGGGGGGCTGGTGGCCCACGG + Intergenic
1084703526 11:70802772-70802794 TGCTGGGGGGTGGGGGCACAGGG - Intronic
1085009614 11:73129275-73129297 GCCTGGGGGTTGGGGACCCCTGG - Intronic
1085886983 11:80533048-80533070 TCCTGGTGGGTGCGGGCTCAGGG - Intergenic
1086694769 11:89829881-89829903 ATCTGGGGGTTGGGGGATAGGGG + Intergenic
1086711379 11:90014616-90014638 ATCTGGGGGTTGGGGGATAGGGG - Intergenic
1087207432 11:95411796-95411818 ATCGGGGGGTGGGGGGCTGAGGG + Intergenic
1087554249 11:99694664-99694686 GCCAGGGGGTGGGGGGCTCGGGG - Intronic
1087560521 11:99784294-99784316 ATGTGGGGGTGGGGGGCTAAGGG - Intronic
1087841154 11:102922477-102922499 GCCTGGAGGTTGGGGGCTGGAGG - Intergenic
1088056067 11:105580307-105580329 AACAGGGGGTTGGGGGCTAGGGG + Intergenic
1088599047 11:111459686-111459708 TCCTGAGGGCTCGGGGCTCATGG + Intergenic
1088644609 11:111907780-111907802 GCCTGGGGGTTGGGGACCCCTGG - Intergenic
1089215444 11:116832005-116832027 ACTTGGGGGTTGGGGACCCCTGG + Intronic
1089334369 11:117712995-117713017 TCCTGGGTGTTGGGGGGTTACGG - Intronic
1089366699 11:117924957-117924979 CCCTGGGGGTGGGGGGCACGGGG + Intronic
1089497706 11:118916139-118916161 GCCTGGGGGATGAGGGCTCAGGG - Intronic
1089610117 11:119664339-119664361 CACTGGGGGTGGAGGGCTCAAGG - Exonic
1089845413 11:121454271-121454293 AACTGGGAGTTGGGGGCTGGTGG + Intronic
1091393815 12:141647-141669 TCCTGGGGGAGGGGGGCTGAGGG - Intronic
1091490154 12:925896-925918 ACTTGGGGACCGGGGGCTCAAGG + Intronic
1092193847 12:6537470-6537492 ACCCTGGGGTTGGGGGTTCTGGG + Intronic
1092256421 12:6928547-6928569 GCCTGAGGGCCGGGGGCTCAGGG + Intronic
1092262489 12:6960004-6960026 ACCTGGGGGTTTGGGGGTGGGGG + Intronic
1092630332 12:10369762-10369784 TCCTGGGGCTTGAGGCCTCATGG - Intergenic
1094719144 12:33044511-33044533 GCCTGGGGGTTGGGGACCCCTGG + Intergenic
1094747608 12:33363850-33363872 CCCTGGGGGTTGGGGACTCCTGG - Intergenic
1097431695 12:59516519-59516541 ACCTGGGGGGTTGGGGGTAAGGG - Intergenic
1097802435 12:63929061-63929083 GCCTGGGGGTTGGGGACCCCTGG + Intronic
1098601892 12:72341278-72341300 ATCAGGGGGTTGGGGGCTGGGGG - Intronic
1098858577 12:75682205-75682227 GTCTGGGGGTTGGGGGCTAGGGG + Intergenic
1100066060 12:90646617-90646639 ATTGGGGGGTTGGGGGCTAAGGG + Intergenic
1100403995 12:94257212-94257234 GCCTGGAGGTTGGGGGCTGTGGG + Intronic
1100641996 12:96491051-96491073 ACCTTGAACTTGGGGGCTCAAGG + Intronic
1101686700 12:107030924-107030946 AGCTGGGGGTTGGGGGTACCTGG + Intronic
1102525990 12:113512654-113512676 ACCTGGAGGTGGGGGCCTCTGGG - Intergenic
1102658342 12:114502706-114502728 TCCTGGGAGATGGGGGCACAGGG - Intergenic
1102870611 12:116411163-116411185 ACCTGGGGCTTGCGGGTGCAGGG + Intergenic
1103710037 12:122905625-122905647 GTCAGGGGGTTGGGGGCTAAGGG + Intergenic
1104321776 12:127758298-127758320 CTCTGGGGGTTGGGGGGTAAGGG + Intergenic
1104440689 12:128791122-128791144 CCCTGGGGGTGGGGGGCACGAGG + Intergenic
1104759832 12:131290144-131290166 CGCTGGGGGAGGGGGGCTCAGGG - Intergenic
1104820895 12:131677105-131677127 CGCTGGGGGAGGGGGGCTCAGGG + Intergenic
1104898519 12:132175817-132175839 CCCTGGGGGGTGGGGGGGCAGGG - Intergenic
1104978494 12:132562493-132562515 GCCTGGGGGTTGGTGGCTGGGGG + Intronic
1105428080 13:20312893-20312915 ACCATGGGGTAGGGGGTTCATGG + Intergenic
1106765488 13:32909232-32909254 ACCTGGGAGTTTGGGGCTGAGGG + Intergenic
1107874513 13:44778233-44778255 GCCTGGGGGTTGGGGACCCCTGG + Intergenic
1108000516 13:45901780-45901802 ACTTGGGGGTTGGGGGTTAGGGG - Intergenic
1108457869 13:50634635-50634657 GCCCTGGGGTTGGGGGCTCCTGG + Intronic
1110983497 13:81934107-81934129 TGGTAGGGGTTGGGGGCTCAGGG + Intergenic
1111199078 13:84910097-84910119 ATCTGGGGGTTGGGGGCAAGGGG + Intergenic
1113493911 13:110713555-110713577 CCCTGGGGGCTGCGGGCTCCAGG - Intronic
1113509962 13:110845885-110845907 ACCTGGGAGTTTGGTGCTGAAGG + Intergenic
1113521760 13:110946584-110946606 ACCAGGAGGTTGGGGACTCCTGG + Intergenic
1113706135 13:112434119-112434141 ACCAGGAGGTTGGGGACTCCTGG - Intronic
1113836465 13:113331311-113331333 ACCTGGGGGTTGGGGGCTCAGGG + Intronic
1115275975 14:31608851-31608873 GCCTGGGGGTTGGGGACCCCTGG + Intronic
1117942358 14:60981501-60981523 CCCTGGGGGATGGGGTCTGAAGG + Intronic
1117976043 14:61297806-61297828 GCCTGGGGGTTGGGGACCCCTGG + Intronic
1118983238 14:70732727-70732749 ACCAGGGGGTTGTGGGTACATGG + Exonic
1119889900 14:78174832-78174854 ACCCGTGGGTGGGTGGCTCATGG + Intergenic
1120415807 14:84216783-84216805 GCCTGGGGGTGGGGGGTGCAGGG + Intergenic
1120838743 14:89064416-89064438 ACATGGGGGTTAGGGGCAGAAGG - Intergenic
1121045745 14:90786226-90786248 AGCTGGGGCTTGGGGCCTCGGGG + Exonic
1122148098 14:99706116-99706138 CCCTGTGGGTTGGGAGCTCTGGG + Intronic
1122503021 14:102213834-102213856 ACCTAGGGGTTGGGGGCGGCTGG + Intronic
1122695685 14:103551013-103551035 TCCTGGGGCTCTGGGGCTCATGG + Intergenic
1122897782 14:104768976-104768998 ACCTGGGGCTGGGGGGCAGATGG + Intergenic
1122983998 14:105203847-105203869 ACCTGGGGGTTGGGGGAGCCTGG + Intergenic
1123909650 15:24954829-24954851 ACCTGGGGGGAGGGGGCTACTGG - Intronic
1124473214 15:30007367-30007389 GCCTGGGGCTGGGGGGTTCATGG + Intergenic
1124856981 15:33398736-33398758 ACCAGGAGGTTGGGGGGTGATGG + Intronic
1124883048 15:33659912-33659934 GCCTGGGGGTGGGGGGCTTATGG - Intronic
1125750217 15:42022803-42022825 GCCAGGGGGTTGGGGGCCCCTGG + Intronic
1126163499 15:45634874-45634896 ACCAGGGCGTTGAGCGCTCACGG - Exonic
1126740002 15:51768112-51768134 AGCTGAGGGCTGGGGGCTCTGGG - Intronic
1127703901 15:61528346-61528368 ACCTGGTGGTTGTGAGCTAAGGG - Intergenic
1127717517 15:61663815-61663837 ACCTGGGGGATGGGAAGTCAGGG - Intergenic
1128084599 15:64877279-64877301 ACCTGGGACTTATGGGCTCAAGG - Intronic
1129985067 15:79911873-79911895 GCCTGGGGGTTGGGGACACTTGG - Intronic
1130914772 15:88296430-88296452 GCCTGGGGGATGTGGGCTGAAGG + Intergenic
1131049319 15:89335731-89335753 GCCTGGGGGTTGGGGTCTGGAGG + Intergenic
1132055367 15:98647832-98647854 GCCCGGAGTTTGGGGGCTCAGGG - Intergenic
1132598764 16:764772-764794 GGCAGGGGGTTGGGGGCTGAGGG - Intronic
1132609718 16:809375-809397 GCCTGGGGGTCGGGGGACCAAGG - Intronic
1132611477 16:818471-818493 ACCTAGAGTTGGGGGGCTCAGGG + Intergenic
1132670888 16:1101946-1101968 TCTTGGGGGCTGGGGGCTCTGGG - Intergenic
1132748276 16:1445888-1445910 CTCTGGGGGTTGGGGGACCAAGG + Exonic
1133111335 16:3549871-3549893 AACAGGGAGTTGGGGGCTCCAGG + Intronic
1133237732 16:4395408-4395430 AGCTGGGGGTTGGGAGGTGAGGG - Intronic
1134096969 16:11424471-11424493 ACCTGGAGCTATGGGGCTCAGGG - Intronic
1134388893 16:13800350-13800372 ACCTAGTAGGTGGGGGCTCAGGG - Intergenic
1134624698 16:15715119-15715141 GGCTGGGGGCTGGGGGCTCGAGG + Intronic
1136292803 16:29285796-29285818 ACCCTGGGGTGGGGGGCTCCAGG + Intergenic
1137039541 16:35597937-35597959 TCCTGGGGCTTGAGGCCTCATGG + Intergenic
1137436149 16:48455675-48455697 AACTGGGAGCTGGGGGCTCTTGG - Intergenic
1137577000 16:49606588-49606610 ACCTGTGGATAGGGGTCTCAGGG + Intronic
1137698015 16:50475358-50475380 ACCTGGGGGTGAGGGGGTCGAGG - Intergenic
1138024423 16:53511637-53511659 AGGTGGTGGTTGGGGGCTGAGGG - Intergenic
1138306043 16:55975629-55975651 ACCAGGGGGTGGGGGGCTAGGGG + Intergenic
1138514012 16:57526035-57526057 GCCTGGGGGCTGGGGGCCCGCGG - Exonic
1139449113 16:67016198-67016220 ACCTTGGGGTGGGAGGCTGATGG + Intergenic
1139523174 16:67496995-67497017 ACCTGGGGGTGGAGGGAGCAGGG + Intergenic
1140424727 16:74851284-74851306 GCCTGGGTCTTGGGGGCTCCTGG - Intergenic
1140580276 16:76223253-76223275 AGCTGGGGGGTGGGGGGGCAGGG + Intergenic
1140979353 16:80091762-80091784 ACCTGCGGGTGGAGGGATCATGG - Intergenic
1141638409 16:85327942-85327964 ATCTGGGGGTGGGGGGCACCAGG - Intergenic
1142112747 16:88340927-88340949 CCCTGGGGGTTGGGGTAGCAAGG + Intergenic
1142142282 16:88477987-88478009 ACCTGGGGGTGGGTGGGTCTGGG + Intronic
1142289578 16:89187408-89187430 ACCTGGGGATGTGGGGCACAGGG - Exonic
1142878124 17:2864609-2864631 GGCTGGGGGTTGGGAGCTCTGGG + Intronic
1142970939 17:3611090-3611112 AGCTGGTGGTTCTGGGCTCAGGG + Intronic
1143099762 17:4498752-4498774 CCCTGGGGGTGGGGGGCCCGGGG - Intergenic
1143304348 17:5933977-5933999 TTTTGGGGGTTGGGGGCTGAGGG + Intronic
1143736121 17:8913156-8913178 TCCAGGGTGTTGGGGGGTCAGGG + Intronic
1145007287 17:19344838-19344860 TCCTTGGGGTTGGGGGCTGGTGG - Intronic
1145388659 17:22437520-22437542 GCATGGGGGTTGGGGGCGAAGGG - Intergenic
1146766754 17:35529690-35529712 ATCTGGGGGTGGGGGGCTAGGGG + Intronic
1147214931 17:38893536-38893558 CCTCGGGGGTTGGGGGCTGAGGG + Intronic
1147869040 17:43574373-43574395 ACCTGGGTGTTGGGAGCTAGAGG + Intronic
1148081602 17:44970118-44970140 GCCCAGGGGTAGGGGGCTCAGGG + Intergenic
1148108291 17:45130918-45130940 ACCTTGGGGGTGGGGGAACAGGG - Intronic
1148155908 17:45425220-45425242 ACCTGGGGGTTGGGGGTGGGGGG + Intronic
1148487226 17:47998244-47998266 ATCTGGTGGTTCGGGGATCAGGG + Intergenic
1148674509 17:49437633-49437655 AAGTGGGGGTTGGGGGCTGGTGG - Intronic
1148741911 17:49897844-49897866 TCCTGGGGTTTGGGGGTTCCAGG - Intergenic
1148851098 17:50555756-50555778 ACCTGGTGGCAGGGTGCTCAGGG - Exonic
1149598951 17:57880993-57881015 ACCTGAGGTCTGGGGGCTCTGGG - Intronic
1150248150 17:63691281-63691303 ACCTGGGGGCTGGGGCCTGCAGG + Intronic
1150631152 17:66881397-66881419 AGCTGGGGGATGGGGGGTAAAGG - Intronic
1151578104 17:74962934-74962956 GCCTGGGGGTGGGGGGCTGGGGG + Intronic
1151605256 17:75131519-75131541 ACCTGGCGGTAGGGGGCGCAGGG - Exonic
1152100757 17:78300674-78300696 ACCTGGGGGCCAGGGGCTCCGGG - Intergenic
1152352700 17:79792334-79792356 ACCTGGGGGGTGGGTGGGCAGGG - Exonic
1152364015 17:79844834-79844856 TCCCTGGGGTTGGGGGCTCGGGG - Intergenic
1152389424 17:79993869-79993891 GCATGGGGGCTGGGGGCTCCTGG - Intronic
1152492740 17:80648690-80648712 ATTTGGGGGTGGGGGGCACAAGG - Intronic
1152779472 17:82219899-82219921 AGCTGGGGGCTGGGGGGTCAGGG - Intergenic
1152919593 17:83059371-83059393 ACCTGGGGGCTGGGGGTGCCTGG - Intergenic
1152928716 17:83099496-83099518 ACCTGGGGGTAGGGGGCACTGGG - Intergenic
1153395663 18:4617699-4617721 GCCTGGGGGTTGGGGACCCCTGG - Intergenic
1153903397 18:9638636-9638658 ACCTGGGGCTTGGGCGCAGAGGG - Intergenic
1154251763 18:12750817-12750839 ACCTTAGGCTTGGGAGCTCAGGG + Intergenic
1156371024 18:36471283-36471305 AGCTGGGGTGTGGGGCCTCAGGG - Intronic
1156503878 18:37577007-37577029 ACCAGGGGGCTGTGGGCTGAGGG + Intergenic
1160144653 18:76353583-76353605 TCCTGGGGGTTGGGGGTTTAGGG + Intergenic
1160509181 18:79443806-79443828 ACCTCGGGGCTGGGGTCTCTGGG - Intronic
1160895333 19:1399712-1399734 TCCTGGGGGTTGGGGGCCTGGGG - Intronic
1161142086 19:2653972-2653994 ACCCGGCGGTGGGGGGCCCAGGG - Intronic
1161260919 19:3337318-3337340 ACCTGGGGGTTGGGACCACAGGG - Intergenic
1161424915 19:4198243-4198265 GGCTGGGGGCTGGGGGCTGAGGG - Intronic
1161558129 19:4955879-4955901 GCCTGGGAGTTGGGAGTTCAAGG - Intronic
1161767112 19:6213962-6213984 TCTGGGGGGGTGGGGGCTCACGG + Exonic
1161846913 19:6717010-6717032 ACCTGGGTGTTGGAGGAACAGGG + Intronic
1161978210 19:7617676-7617698 ACGTGGGAGTTGGGGGCTGGTGG + Intronic
1161988122 19:7668995-7669017 ACCGGAGGGTTGGGGGCCCAGGG + Intergenic
1162095308 19:8306603-8306625 AGTGGGGGGTTGGAGGCTCATGG - Intronic
1162099539 19:8331556-8331578 ACCTGGAGGGAGGGGGCTCCTGG + Intronic
1162363880 19:10236288-10236310 ACCTGGGGGGTTGGGGCAGAGGG + Intergenic
1162782121 19:13011874-13011896 GACTGGGGGGAGGGGGCTCATGG + Intronic
1162782302 19:13012590-13012612 GCGCGGGGGTTGGGGGTTCAGGG + Intronic
1163064186 19:14781042-14781064 ACCTGGGGGTTTGGGGCCCCTGG + Intergenic
1163329605 19:16628059-16628081 GCCGGGGGGTTGGGGGCGCGCGG + Exonic
1163382505 19:16978288-16978310 ACTTGGGGGTGGGGGTTTCAGGG - Intronic
1163529989 19:17843334-17843356 CCCAGGGGGTTGGGGGTCCAAGG - Intronic
1163533230 19:17862784-17862806 GCCTGAGGGCTCGGGGCTCACGG - Intronic
1163551835 19:17969764-17969786 AGCTGGGGATGGGGGGCACAGGG - Intronic
1163668343 19:18613395-18613417 AGCTGGGGGTTGGGTGCTAGAGG - Intronic
1164587381 19:29484451-29484473 CCCTGGGGCCTGGGAGCTCAGGG + Intergenic
1165351905 19:35280168-35280190 CCCTGGGGGTGAGGGGCTCAAGG - Intergenic
1165841842 19:38792781-38792803 GCCAGGGGGTCGGAGGCTCAAGG - Intergenic
1165951527 19:39476235-39476257 ACCTGGGGGTGGGGGGAATATGG - Exonic
1165981189 19:39725685-39725707 GTCTGGGGGTTGGGGGCTAGGGG + Intergenic
1166065916 19:40358861-40358883 CCCTGGGGGTGGGGTGTTCAGGG + Intronic
1166214177 19:41325101-41325123 ACCTGGGGGTGGTGGGCCCCAGG + Intronic
1166265692 19:41682891-41682913 ACCTGGGGCTTTGGGGCTGAGGG + Intronic
1166304829 19:41931817-41931839 ATCTTGGGGTGGGGGGCTCCTGG - Intergenic
1166798192 19:45440430-45440452 ACCTGCGGGCTGAGGGCTGAGGG + Intronic
1166871380 19:45872967-45872989 ACGTGGGGTTTGGGGGCTACGGG + Exonic
1167113315 19:47474493-47474515 CCTAGGGGGTTGGGGGCCCAGGG - Intergenic
1167223220 19:48217252-48217274 GCCCGGGGGTTGGGGACTCCTGG + Intronic
1167462931 19:49635851-49635873 ACCTGGGGGTAGGGGGGACACGG + Exonic
1167556184 19:50197414-50197436 TCCAGGGGGATGGGTGCTCAAGG + Intronic
1168258269 19:55179014-55179036 GCCCCGGGGTTGGGGGCTCCGGG + Exonic
1168529606 19:57117353-57117375 ACCTTGAGGTTGGGAGTTCAAGG + Intergenic
1202704610 1_KI270713v1_random:13747-13769 ATCTGGGGATTGGGAGCTGATGG + Intergenic
924973553 2:153477-153499 ACCTGGGGTTCGTGGCCTCATGG + Intergenic
925435924 2:3837523-3837545 TTCTGGGGGTGGGGGGCCCATGG + Intronic
926773410 2:16398256-16398278 ATCTGGAGGCTGGTGGCTCAGGG + Intergenic
926865025 2:17346589-17346611 ACCTGGGGTTTTTGGCCTCATGG - Intergenic
927088867 2:19695168-19695190 AGCTGGGGGCTGGGGGATCAGGG + Intergenic
927515652 2:23670280-23670302 ACCTGGGGGTTGGGAGGACGGGG + Intronic
927773600 2:25884725-25884747 ACCAGGGGGTGGGGGGCTAAGGG + Intergenic
927914836 2:26928994-26929016 ACCTGGGGGTTGGTGACCCCTGG - Intronic
928089109 2:28363384-28363406 ACATGGGGGGTGAGGGCTCAGGG - Intergenic
928208614 2:29306091-29306113 GCCTGGGGGTTGGGGACCCCTGG + Intronic
928949040 2:36798392-36798414 ACCTGAGGGATGGGGGCTGATGG + Intronic
929795396 2:45055066-45055088 AGCTGGGGGCTAGGGGCTCAGGG + Intergenic
931933997 2:67175237-67175259 ATCTTGGGGTTGGGGGGACAGGG + Intergenic
932706557 2:74030682-74030704 AGCTGGGTGATGGGGGTTCAAGG + Intronic
933836551 2:86250614-86250636 ATCTCGGGGTTGGGGGTCCAGGG - Intronic
934609745 2:95726195-95726217 ACCCAGGGGTTGCAGGCTCAGGG + Intergenic
935215160 2:100970197-100970219 CCCTGGGGGTAGGGGGCCCTTGG - Intronic
935359203 2:102233262-102233284 GGCTGGGGGCTGGGGGCTGACGG - Intronic
936176121 2:110221495-110221517 ACCTGGGGGATAAGGGCTCAGGG + Intergenic
936543064 2:113367765-113367787 ACCCAGGGGTTGCAGGCTCAGGG + Intergenic
937151895 2:119691879-119691901 ACCTGGGGATCGGTGGCTGAGGG - Intergenic
937220524 2:120340586-120340608 ACTTGGGGGTGGGGGTGTCAGGG + Intergenic
937297860 2:120820542-120820564 ACCTGGGGGTTGCTGGGGCAGGG - Intronic
937470438 2:122169645-122169667 ACCTGGGGGTGGGGGAGTCTTGG + Intergenic
937808101 2:126169393-126169415 AGCTGGAGGTTGGGGGCTAGGGG + Intergenic
937913981 2:127089979-127090001 AGCTGGGGGTTGGGGGAGTAGGG - Intronic
937960139 2:127452217-127452239 ACCGGAGGGTAGGGGACTCAAGG - Intronic
938985513 2:136571601-136571623 GCCTGGGTGTTGGGGGCTGCTGG + Intergenic
939672035 2:145024668-145024690 ACCAGGGGGATGGGGGATGAGGG - Intergenic
940769516 2:157825405-157825427 GCCTGGGGGTTGGGGACCCCTGG - Intronic
940808167 2:158211031-158211053 ACTTGGGGGTTGGGGGCTAGGGG + Intronic
942826764 2:180187065-180187087 ACCTGGGAGGTGGGGGCTGCAGG + Intergenic
942906473 2:181187140-181187162 GGGTGGGGGTTGGAGGCTCATGG - Intergenic
944272546 2:197799881-197799903 ACCTGGGATTTGGGGGCTCGAGG + Intergenic
945279550 2:208023425-208023447 ACATGGGGGTTGGGGACTCCTGG - Intronic
946806387 2:223474981-223475003 GCCTGGGGGTTGGGGACCCCTGG - Intergenic
947593315 2:231396704-231396726 ACCTGGGGGCTGAGAGCTCTGGG - Intronic
948027489 2:234789612-234789634 AGCTGGGGGTTTGGGAATCATGG - Intergenic
948559517 2:238842279-238842301 CCCTGGGGGTAGGGGGCCCAAGG - Intergenic
948728505 2:239949002-239949024 AGCTTGGGGTTGGGGGCTCCAGG - Intronic
1168795090 20:606048-606070 ACCTGGGGGTGGAGGGGGCAGGG - Intronic
1169110106 20:3027216-3027238 CACGGGGTGTTGGGGGCTCAGGG - Intronic
1171375846 20:24693793-24693815 AACTCGGGGGTGGGTGCTCAGGG - Intergenic
1171482186 20:25462333-25462355 AGCTGGAGGCTGGGAGCTCAGGG - Intronic
1172120706 20:32597072-32597094 AGCTGGGGGTAGGAGACTCAGGG - Intronic
1172240630 20:33410330-33410352 GTCTGGGGGTTGGGGGCAGAGGG + Exonic
1172699759 20:36845832-36845854 AGCTGGGGGTGGGGGGCCCTGGG + Intronic
1172778542 20:37422397-37422419 CCCTGGGAGTTGGGAGCACAGGG - Intergenic
1172849746 20:37952934-37952956 ACTTAGGGGTTGAGGGTTCAGGG + Intergenic
1173095626 20:40025326-40025348 GCCTGGGGGATGGGGACTCCTGG + Intergenic
1173985765 20:47260167-47260189 ACCTGGGGTTGGGGTGCTCCTGG - Intronic
1174827121 20:53778431-53778453 GCCTGGGGCTTGGGGGATCCGGG + Intergenic
1174868877 20:54165103-54165125 GCCTGGGGGTTGGGGACCCCTGG - Intronic
1175504719 20:59473390-59473412 GCCTGGGGGTTGGGGACCCCTGG + Intergenic
1175647541 20:60687507-60687529 ACCTGGGAGATGGGGGTTGAGGG + Intergenic
1175736266 20:61389711-61389733 ACCTGGTGGGTGGGGGCTGGGGG + Intronic
1175957892 20:62621010-62621032 ACCGGAGGGGTGGGGGCACAGGG - Intergenic
1175966115 20:62661017-62661039 GGCTGGGGGCTGGGGGCTCCCGG - Intronic
1176129539 20:63490850-63490872 GCCTGGGGGTTGGGGCCACATGG + Intronic
1179088082 21:38238111-38238133 ACCTGGTGGCAGGGTGCTCAGGG + Intronic
1179349959 21:40599367-40599389 GCCAGGGGGTTGGGGGCCAAGGG - Intronic
1179522995 21:41957350-41957372 AGCTGGGAGCTGGGAGCTCAAGG - Intergenic
1179980672 21:44894182-44894204 CTCTGGGGGTTTGGGGCTCACGG + Intronic
1180215151 21:46318783-46318805 ACCTTGGGGCTGGGGGCACTGGG + Intronic
1180877344 22:19180698-19180720 CCCAGGGGGTTGGGGGCTACAGG + Intronic
1180906131 22:19413254-19413276 AAATGGGGGTGGGGGCCTCAAGG + Intronic
1180959198 22:19755070-19755092 AACTGGGGGCTGGGGACTCCTGG - Intergenic
1180965975 22:19788175-19788197 ACCTGTGTGTTGGGAGCTCCTGG + Exonic
1181020949 22:20102023-20102045 AGCTGTGGGTTGGTGGTTCATGG + Intronic
1181024115 22:20117814-20117836 GCGTGGGGTTTGGGGGCTCGAGG + Intronic
1181055226 22:20257836-20257858 CCCTGGGGTGTGGGGGCTCATGG - Intronic
1181164094 22:20974201-20974223 ACCTGGGGGTGTGGGGTTCGGGG + Intronic
1181407116 22:22692921-22692943 CACTGTGGGCTGGGGGCTCAGGG - Intergenic
1181467035 22:23115903-23115925 CCCAGGGGGTAGGGGGATCAGGG - Intronic
1181988600 22:26819817-26819839 GCCTGGGGGTTGGGGACCCCTGG - Intergenic
1182095580 22:27623158-27623180 CCCAGGGGGTTGGGAGCCCATGG - Intergenic
1182227908 22:28814009-28814031 AACTGGGGCTTGGTGGCTTATGG + Intergenic
1182425038 22:30267236-30267258 ACACGGTGGTTGGGGGCTGAGGG + Intergenic
1182708529 22:32305828-32305850 ACGTGGGGGGTGGGGGGACAGGG - Intergenic
1183407980 22:37639755-37639777 AGCTGGGGGCTGCGGGGTCACGG - Exonic
1183660611 22:39218802-39218824 GCCGTGGGGTTGGGGGCTGAGGG + Intergenic
1183731604 22:39621638-39621660 GCCTGGGGGCTGGGGTCTCAAGG + Intronic
1183856995 22:40641432-40641454 ACCTTGGGGTTGGGGGGTGGGGG + Intergenic
1184021899 22:41826633-41826655 ACCTGTGGGTGGGGGGCTGCAGG + Intergenic
1184225537 22:43127280-43127302 CCCTGTGGGAAGGGGGCTCAAGG + Intronic
1184233722 22:43171983-43172005 AACTAGGGGTTCAGGGCTCAGGG + Intronic
1184334587 22:43845640-43845662 GCCTGGGGGTTGGGGACCCCTGG - Intronic
1185331739 22:50255069-50255091 ACCCGTGAGTTGGGGGCTCCGGG - Intronic
1185331751 22:50255106-50255128 ACCTGTGAGTTGGGGGCTCCGGG - Intronic
950204525 3:11068541-11068563 ACGTGGGGTTTTGGGGCTCTAGG + Intergenic
950715685 3:14846212-14846234 ATGTGTGGTTTGGGGGCTCAGGG + Intronic
951985787 3:28619429-28619451 GTCAGGGGGTTAGGGGCTCAGGG - Intergenic
953202097 3:40786871-40786893 GCCTGGGGGTTGGGGACCCCTGG + Intergenic
953438890 3:42901124-42901146 ACTTGGGGGTTGGGGTTTTAAGG + Intronic
954374666 3:50188010-50188032 CCCTGGGGCTGGGGGGCACATGG - Exonic
954452787 3:50580712-50580734 ACCTGGGAGTAAGGGGGTCAGGG - Exonic
954610093 3:51940370-51940392 CCCTGTGGGTTGGAGGCTCTTGG - Intronic
954680671 3:52344324-52344346 ACTTGGAGGTTAGTGGCTCAGGG + Intronic
954704034 3:52469270-52469292 ATGTGGGGGTGGGGGGCTGAGGG + Intronic
954751846 3:52818255-52818277 ACCTGGGGTTTGGGTTGTCATGG + Exonic
954755073 3:52834794-52834816 CCTTGGGAGATGGGGGCTCAGGG - Intronic
954836737 3:53476394-53476416 GCCAGGGAGTGGGGGGCTCAGGG - Intergenic
954860891 3:53689466-53689488 GCCTGGGGGCTGGGGGCTGGGGG + Intronic
955961661 3:64346863-64346885 ATCTGGGAGTTGGGGGCACATGG + Intronic
956438705 3:69259414-69259436 GCCTGGGGGTTGGGGACCCCTGG + Intronic
956740558 3:72272435-72272457 GCCTGGTGGTTCGGGGCACAGGG + Intergenic
959021790 3:101195519-101195541 AAATGGGGGCTGGGGACTCAGGG - Intergenic
959222757 3:103542649-103542671 ACATAGGGGTTGGGGGTTAAGGG - Intergenic
961151744 3:124644471-124644493 GTCTGGGGGTTGGGGGCTAGGGG - Intronic
961491203 3:127257853-127257875 AGCTGGAGGCTGGGGGCTGATGG - Intergenic
961553906 3:127684842-127684864 ACCTGTCGGTTGGGGGCTTTAGG - Intergenic
961865831 3:129952928-129952950 ACATGGGGGTGGGGAGCCCAGGG + Intergenic
962239549 3:133740329-133740351 CTCAGGGGGTTGGGGGCTAAGGG + Intergenic
963356640 3:144216121-144216143 GCCTGAGGGTTGGGGGCCCCTGG + Intergenic
965304835 3:167051519-167051541 CCCTGGGGGTTGGGGACCCCTGG - Intergenic
965478681 3:169189385-169189407 CCCTGGAGTTTGGGGACTCAAGG - Intronic
966463470 3:180203302-180203324 ACCTGGGTTTGGGGGGCACATGG + Intergenic
967505062 3:190244449-190244471 ACCTATGGGTTGAGGGTTCAAGG + Intergenic
968065667 3:195757633-195757655 TCCTGGGGGATGGAGGATCAAGG + Intronic
968438121 4:606002-606024 GCCTGGGGGTTGGGGACCCCTGG - Intergenic
968456408 4:702810-702832 GACTGGGGGTGGGGGGCCCAAGG + Intergenic
968855740 4:3120455-3120477 GCCTGGGGGTTGGGGACCCATGG - Intronic
969131583 4:4994613-4994635 ACCTGGGGGCAGGGAGCTCCCGG + Intergenic
969674666 4:8608140-8608162 AGCTGGGGGCTGGGGGCTGGGGG - Intronic
971240705 4:24886288-24886310 ACCTGGTGGTTGGTGGTTCCTGG - Intronic
972923108 4:43968173-43968195 CCCTGGGGGTTGGGGGCCCTTGG - Intergenic
973229402 4:47824600-47824622 ACCTGGGGCATGGTGGCTCATGG - Intronic
973870801 4:55164420-55164442 ATCAGGGGGTTGGGGGCTGGGGG - Intergenic
974648447 4:64724697-64724719 ACCTGGGGCTTTTGGCCTCAGGG + Intergenic
975021893 4:69501135-69501157 AGCTGGGGGTTGGGTGCAGAGGG + Intronic
976399017 4:84586670-84586692 GCCTGGGGGTTGGGGACCCCTGG + Intronic
977114894 4:93011517-93011539 TGCTGGGGGCTGGGGGCTCCTGG - Intronic
978660436 4:111119898-111119920 GTTTGGGGGTTGGGGGCTAAGGG + Intergenic
979386991 4:120078474-120078496 GCCTGGGTTTTGGGGGATCATGG + Intergenic
979542245 4:121898248-121898270 ATCTGCGGGTTGGGGACTCCTGG - Intronic
980017124 4:127662637-127662659 GCCTGGGGGTTGGGGACCCCTGG - Intronic
981479022 4:145217422-145217444 GACTGGGGCTTGGGGGGTCAAGG + Intergenic
981920566 4:150080032-150080054 ATCTGGGGGTTGGGGGATCAGGG - Intronic
982079855 4:151778714-151778736 GCCTGGGGGTTGGGGACCCCTGG - Intergenic
983678333 4:170322366-170322388 GTCTTGGGGTTGGGGGCTCGGGG + Intergenic
983870671 4:172821949-172821971 CCCTGGAGACTGGGGGCTCAGGG - Intronic
984102157 4:175499511-175499533 AGCTGAGGTTTGGGGGCTGAGGG - Intergenic
984336103 4:178393527-178393549 GCCAGGGGGTTGGGGGCTAGGGG - Intergenic
985493782 5:193420-193442 TTCTGGGGGCTGGGGGCACATGG + Intronic
985520569 5:372270-372292 AGCTGTGGGCTGGGGCCTCATGG + Intronic
985714643 5:1448488-1448510 CCCTGGGGGTAGGGGGCTTGGGG + Intergenic
985848696 5:2372880-2372902 GTCTGGGGGTTGGGGGCTAGGGG - Intergenic
985882479 5:2649361-2649383 GTCAGGGGGTTGGGGGCACACGG - Intergenic
986112256 5:4731014-4731036 ACCCAGGGGTTGGGGACTCCTGG - Intergenic
986740809 5:10703765-10703787 GCCTGGGTGTGGGGGGCACAGGG + Intronic
988881521 5:35508406-35508428 ACCTGAGGTTTGTGGCCTCATGG - Intergenic
989506051 5:42228817-42228839 GCATGGGGGAAGGGGGCTCAGGG + Intergenic
990442562 5:55861286-55861308 GCCTGGGGGTTGGGGACCCCTGG - Intronic
990828968 5:59935015-59935037 ACCTGGTGGTTGTGGGCAGATGG + Intronic
991290657 5:65031135-65031157 ACCTGGGGTTCTTGGGCTCACGG - Intergenic
992314400 5:75537270-75537292 GCATGGGGGTGGGGGGCACAGGG + Intronic
993736482 5:91482747-91482769 ATCTGGGGGAAGAGGGCTCAGGG - Intergenic
993821068 5:92617631-92617653 AACTGGGGGCTGGGGGGTGAGGG - Intergenic
993900157 5:93579585-93579607 ACCCGGGGGCTGGGGGGTCTCGG - Intergenic
994748986 5:103715335-103715357 TGCTGGGGGTCGGGGGCTGAGGG + Intergenic
994943744 5:106359011-106359033 GCCTGGGGATTGGGGACTCCTGG - Intergenic
995099182 5:108278193-108278215 ATTTGGGGGTTGGAGGGTCAGGG - Intronic
995403282 5:111765367-111765389 ACCTTGGGGTTGGAGACTCCAGG + Intronic
995550896 5:113280257-113280279 ACCTGGGGGTGGTGGGTTCCAGG + Intronic
996539228 5:124611640-124611662 GTCAGGGGGTTGGGGGCTGAGGG + Intergenic
997301659 5:132810619-132810641 ACGTGGGGGATGGGGGGTGAAGG - Intergenic
998836074 5:146203857-146203879 ACGTGGGCGTTGGGGGCTCGCGG + Intronic
998935257 5:147227165-147227187 GCCGGGGGGTTGGGGGCAGAGGG - Intergenic
999472109 5:151864223-151864245 AGCTGGGGCTTGGGGACTGAAGG - Intronic
999609459 5:153353377-153353399 TCCTGGGGGGAGGGGGCTAATGG - Intergenic
1000381473 5:160633547-160633569 ATCGGGGGGTTGGGGGCTAGGGG + Intronic
1001379470 5:171294204-171294226 ACCTGGTGAGTGGGGGCTCTGGG - Intronic
1001747020 5:174099812-174099834 ACCTGGGGGCGGGGGCATCAGGG - Intronic
1002020428 5:176361148-176361170 AGCTGGGGGGTGGGGGCACAGGG - Intronic
1004148536 6:13092267-13092289 GCCTGGGGGTTGGGGACCCCTGG + Intronic
1004426394 6:15510108-15510130 ACCTGGGGGGCGGGGGCTGTGGG + Intronic
1004924558 6:20403939-20403961 AACGGGGGGTTGGGTGCTCGAGG + Intronic
1005926748 6:30451396-30451418 GGCTGGAGGGTGGGGGCTCATGG - Intergenic
1006103088 6:31698840-31698862 ACATGGGGGTGGTGGGGTCAGGG - Intronic
1006410963 6:33872967-33872989 ACCTGGGGGTTGGGGCTTTGGGG - Intergenic
1006668298 6:35713611-35713633 AGCTGGCGGGTGGGGGCCCAAGG + Intronic
1007401993 6:41607975-41607997 GCCTGGGGGTTGGGGACTCCTGG + Intergenic
1008854793 6:56070744-56070766 GCCTGGGGCTTCTGGGCTCAAGG - Exonic
1009466214 6:63972685-63972707 GTCAGGGGGTTGGGGGCTAAGGG - Intronic
1009630218 6:66188566-66188588 GCCTGGGGGTTGGGGACCCCAGG + Intergenic
1010123842 6:72410604-72410626 GCCTGGGGGTGGGGGGCACTTGG - Intergenic
1010805760 6:80234207-80234229 GCCTGGGGGTTGGGGACCCCTGG + Intronic
1010895075 6:81351757-81351779 ACCTGGGGTTCCTGGGCTCACGG - Intergenic
1013227114 6:108127779-108127801 GCCTGGGGGTTGGGGACCCCTGG + Intronic
1013319683 6:108975150-108975172 ATCAGGGGGTTGGGGGCTAGGGG - Intergenic
1013420445 6:109962060-109962082 ATCTGTGGGTTTGGGGCTCTGGG - Intergenic
1016139110 6:140586150-140586172 ACCTGGGGGATGGGTGCCCATGG - Intergenic
1017045684 6:150345255-150345277 ACCTGGGGGTTGATGGTGCAGGG - Intergenic
1017071106 6:150576285-150576307 ACCTGGAGGCTAGGGGCCCACGG + Intergenic
1017209013 6:151834545-151834567 ATCAGGGGGTTGGGGGCTAAGGG + Intronic
1017913747 6:158817327-158817349 ACCTGGGGGTTGTAGGCACAAGG - Intronic
1018981813 6:168607179-168607201 TCCTTGGGGGTGGGGGCTCCGGG + Intronic
1019051168 6:169185121-169185143 ACCGGGGGGTGGGGGGCTGAGGG - Intergenic
1019265765 7:116710-116732 AAGAGGGGGATGGGGGCTCAGGG - Intergenic
1019326318 7:440094-440116 TCCTGGGGCTTGGGGGCACAGGG - Intergenic
1019543934 7:1564005-1564027 GACTGGGGGATGGGGGCTCCAGG + Intergenic
1019770658 7:2882098-2882120 GCCTGGGTGTGGGTGGCTCAGGG + Intergenic
1019834116 7:3363849-3363871 GCCTGGGGGTTGGGGACCCCTGG + Intronic
1019935083 7:4249538-4249560 ACCTAGGATTTGGGGGCCCAAGG + Intronic
1020279442 7:6642911-6642933 CCCTGCAGGCTGGGGGCTCAGGG + Intronic
1021289177 7:18822252-18822274 GACTGGGGGCTGGGGGCTCCTGG - Intronic
1021775731 7:24053498-24053520 ATATGGGGGTTGGGGGTGCAAGG + Intergenic
1022494949 7:30847006-30847028 GCCTGGGGGTTGGGAACTCCTGG + Intronic
1022941960 7:35249919-35249941 ACTTGGGGGTTGGGGGTTGGGGG - Intronic
1023011032 7:35924974-35924996 ATCTGGGGGTAGGGGGTTCGGGG + Intergenic
1023896097 7:44434234-44434256 ACCTGGCAGCTGGGGGCCCAGGG - Intronic
1024268725 7:47626219-47626241 ACCTTGGACTTGGGGGCACAGGG - Intergenic
1024605016 7:51015762-51015784 GCCTGGGTGTTAGGGGCACAAGG - Intergenic
1026166725 7:67916689-67916711 ACGTGGGGGTTGGGGGATGGGGG - Intergenic
1026776012 7:73231557-73231579 ACCTGGGTGTAGGGGGCAGAGGG + Intergenic
1027016869 7:74784928-74784950 ACCTGGGTGTAGGGGGCAGAGGG + Intronic
1027071158 7:75161008-75161030 ACCTGGGTGTAGGGGGCAGAGGG - Intergenic
1027545835 7:79526512-79526534 CCCAGGGTGTGGGGGGCTCAGGG - Intergenic
1028463384 7:91121311-91121333 CCAAGGGGGTTGGGGGCTGAAGG + Intronic
1029466763 7:100730472-100730494 AAGTGGGGGTGGGGGGCTCACGG - Intergenic
1029777905 7:102697730-102697752 GTTTGGGGGTTGGGGGCTGAGGG - Intergenic
1030102238 7:105956608-105956630 AGCTTGGGGTAGGGGGCTCCAGG + Intronic
1031430068 7:121657137-121657159 GCCTGGGGGTTGGGGACCCCTGG + Intergenic
1032125271 7:129188841-129188863 GGCTGGGGATTGGGGGCCCAGGG + Intergenic
1032848015 7:135768396-135768418 ACCTGTGGAGTTGGGGCTCAGGG - Intergenic
1034530706 7:151694828-151694850 CCCTCGGTGTTGGGGGCACATGG - Intronic
1034832554 7:154322046-154322068 AGCTGGGGGTTGGGGGTTGGGGG - Intronic
1034931729 7:155168491-155168513 ACCTCGGGGTTGGGGGCCGGGGG - Intergenic
1035937191 8:3853715-3853737 ACCTCGGGGTGGGGGGAGCAGGG + Intronic
1036643391 8:10597884-10597906 AGCTGGGGCTAGGGGGCTGAGGG - Intergenic
1036794445 8:11745185-11745207 ACCTGTGTGTTGGGCTCTCAAGG + Intronic
1037742469 8:21618516-21618538 GCCTGGGGGTTGGGGACTCCTGG - Intergenic
1040546226 8:48400128-48400150 GCCTGGGGGTTGGGGACCCCTGG - Intergenic
1041727843 8:61034185-61034207 ACCTGTTAGTTGGTGGCTCATGG - Intergenic
1042114206 8:65413845-65413867 ACCTGGTGGTTGTGGTCCCAAGG - Intergenic
1043383785 8:79729527-79729549 AGCTGGAGTTGGGGGGCTCATGG - Intergenic
1043629755 8:82315167-82315189 GTCTGGGGGTTGGGGGCTAGGGG - Intergenic
1043935846 8:86141220-86141242 GCCTGGGGGTTGGGGACCCCTGG + Intronic
1044062865 8:87661517-87661539 AGTTGGGGGTTGGGGGCACTGGG - Intergenic
1045044312 8:98259817-98259839 AGCTGGGGGCTGGGTGCTCTAGG - Intronic
1045965592 8:108021338-108021360 ATCTGGGAAGTGGGGGCTCAGGG - Intronic
1047285939 8:123487262-123487284 ACATGGGTGTTGGGGGATAAGGG + Intergenic
1048294991 8:133207403-133207425 TCATGGGGGCTGGGAGCTCAAGG - Intronic
1048302094 8:133259338-133259360 ACTTGGGGGTGGGGGGGTCTGGG - Intronic
1049223901 8:141440639-141440661 ACCTGGGGGTAGAGCGCCCATGG + Intergenic
1049316451 8:141971409-141971431 ACCTCGGGGTCTGTGGCTCAGGG - Intergenic
1049403970 8:142443417-142443439 AGGTGGGGGTAGGGAGCTCAAGG + Intergenic
1049555027 8:143277404-143277426 CCCTGGGGTGTGGGGGCCCAGGG + Intergenic
1049571391 8:143371793-143371815 ACGTGGGGGTGGGGAGCTCCAGG + Intronic
1049850804 8:144829206-144829228 ACCTTGGGGTTGGGGGCAAGGGG - Intronic
1050000313 9:1070407-1070429 GCCTGGGGGTTGGGGACCCCTGG + Intergenic
1050318369 9:4426104-4426126 ACCTGGGGGCTCTGGACTCATGG - Intergenic
1050784133 9:9377738-9377760 AGGTGGGTGGTGGGGGCTCAGGG + Intronic
1050863820 9:10471339-10471361 AATTGGGGGTTTGGGGGTCATGG + Intronic
1051725679 9:20086390-20086412 GCTTGGAGGCTGGGGGCTCAAGG - Intergenic
1051831892 9:21288675-21288697 GCCTGGGGGTTGGGGACTCCTGG - Intergenic
1053275843 9:36782701-36782723 GCATGGGGGTTGGGAGCTGATGG + Intergenic
1053827687 9:42042707-42042729 ATTTGGGGGTGGGGGGCTCCTGG + Intronic
1054854137 9:69879845-69879867 ACCTATGGGTTGGGGATTCAGGG - Intronic
1056732415 9:89177944-89177966 CCCTGGGGGCTGGGGGTTCTGGG - Intronic
1056933149 9:90895366-90895388 ACCCTGGGGTGGGGGGCACAGGG + Intronic
1057559300 9:96114803-96114825 ACCTGGGAAGTGGGGGCGCAGGG - Intronic
1057573660 9:96222358-96222380 AGCTGGGGATTGGAGGCTCAGGG - Intergenic
1057843399 9:98503735-98503757 AACTGGGGGTTTCTGGCTCAGGG + Intronic
1058548424 9:106086435-106086457 GTCTGGGGGTTGGGGGCTAGGGG - Intergenic
1060160877 9:121362004-121362026 GCCTGGGAGTTGGGGACTCCTGG + Intronic
1060223112 9:121774734-121774756 ACCTGGGGGTTGAGGGCTGAGGG + Intronic
1060409192 9:123388996-123389018 AGCTGGGGGCTGGGGGGTGAGGG - Intronic
1060791404 9:126488102-126488124 TCGTGGGAGTTGGGGGCTCAGGG + Intronic
1060814155 9:126626047-126626069 ACATGGGGGTGGGGAGCTCGTGG + Intronic
1060822239 9:126668143-126668165 ACTTTGGTGTTTGGGGCTCAGGG + Intronic
1061297384 9:129684111-129684133 ACCTGGGGGTGAGGGGTTCCTGG + Intronic
1061498726 9:130990335-130990357 ACCTGGAAGTGGGGGGCTCCAGG - Intergenic
1061664710 9:132153817-132153839 ACCTGGGAGTTGGAGGGACATGG - Intergenic
1061862348 9:133474498-133474520 ACCTGGGGTCTGTGGCCTCAAGG + Intronic
1061903556 9:133685103-133685125 ATCTGGGGGCTGGGGGCTCTCGG - Intronic
1061946992 9:133914071-133914093 TCCTGGGGCTTAGGGTCTCAGGG - Intronic
1061999623 9:134209427-134209449 ACCTGAGAGTTGGCGGGTCAGGG + Intergenic
1062009308 9:134258698-134258720 GTCAGGGGGCTGGGGGCTCAGGG - Intergenic
1062268745 9:135699361-135699383 GCCAAGGGGTTGGGGGCCCAAGG - Intronic
1062360291 9:136185065-136185087 GCCTGGGGGTCGGGGCCACATGG - Intergenic
1062473806 9:136717962-136717984 ACGTGGGGGCTGGGGGCAGAAGG + Intronic
1062483165 9:136761907-136761929 ACCCAGGGGTTGGGGGCTGCGGG - Intronic
1186411077 X:9344794-9344816 ACCAGGGAGTTGGAGGTTCAAGG - Intergenic
1187542236 X:20208269-20208291 ACCCGGGGGTTGGGGACCCCTGG + Intronic
1187730132 X:22244280-22244302 TCCAGGGGGTCGGGGGCTAAGGG + Intronic
1188874572 X:35414325-35414347 ACCAGGGGGTGGGGGGCTTGGGG - Intergenic
1188949042 X:36345577-36345599 GCCTGGGGGTTGGGGACCCCTGG + Intronic
1190301951 X:49062174-49062196 GGCTGGGGGTTGGGGTATCATGG + Intronic
1191164237 X:57370608-57370630 GCCTGGGGGTTGGGGACCCCTGG - Intronic
1191677182 X:63803745-63803767 TGCTGGGGGTTGGGGGCTGGGGG + Intergenic
1192243926 X:69357921-69357943 TCCTGGGAGCTGGGGGCCCATGG - Intergenic
1192473671 X:71420749-71420771 CCGTGGGGGTGGGGGGCGCAAGG + Intronic
1193801487 X:85942258-85942280 GGTTGGGGGTTGGGGGCTAAGGG - Intronic
1194827805 X:98584128-98584150 AGGTGGGGGTTGGGGGCTTGAGG + Intergenic
1195520450 X:105822854-105822876 ACCTGGGGGCTGGAGGGACAGGG + Exonic
1195716032 X:107819483-107819505 TTCTGGGGGCTGGGGGATCATGG - Intergenic
1196516903 X:116624547-116624569 GTCTGGGGGTTGGGGGCTAGGGG + Intergenic
1196569038 X:117244236-117244258 ACCTGTTGGTTGAGGGTTCAGGG - Intergenic
1196606965 X:117668298-117668320 GTCAGGGGGTGGGGGGCTCAGGG - Intergenic
1197393628 X:125898568-125898590 CCCTGGGAGATGGGGGCTTATGG + Intergenic
1200386440 X:155895753-155895775 GCCTGGGGGTTGGGGACCCCTGG - Intronic
1202329015 Y:23725377-23725399 ACCTGGGAGTTGGAGGTTGAAGG + Intergenic
1202541756 Y:25944677-25944699 ACCTGGGAGTTGGAGGTTGAAGG - Intergenic