ID: 1113838514

View in Genome Browser
Species Human (GRCh38)
Location 13:113345744-113345766
Sequence TTCACCCGGAGCCAAAGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 97}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113838514 Original CRISPR TTCACCCGGAGCCAAAGCAC TGG Intronic
900692392 1:3988398-3988420 CTCACCAGGAACCCAAGCACAGG - Intergenic
902239437 1:15078666-15078688 TTCAGCCAGAGCCACAGCATGGG - Intronic
904333928 1:29784945-29784967 TCCACCCTGGGCCAAAGCAAGGG - Intergenic
904380007 1:30104146-30104168 GTCTCCAGTAGCCAAAGCACCGG - Intergenic
912647472 1:111407619-111407641 TTCACCCTGAGTGAAAGCAGGGG + Intergenic
913133163 1:115861622-115861644 TTCAGCAGAAGCCAATGCACTGG + Intergenic
913507023 1:119526493-119526515 ATCTCCCGGAGACAGAGCACTGG - Intergenic
915255420 1:154625099-154625121 TTCACCCAGAGAAAAAGGACAGG - Intronic
1064535548 10:16354028-16354050 TGCAGCGGGAGCCAAAGAACTGG + Intergenic
1069051767 10:63802869-63802891 TCCATCCAGAGCCATAGCACTGG + Intergenic
1071144135 10:82547676-82547698 TTCAAATGGAGCCAAAACACTGG + Intronic
1072341775 10:94459442-94459464 TCCACCCGCAGCCCCAGCACAGG - Intronic
1075562380 10:123477714-123477736 TTAACCCACAGGCAAAGCACAGG - Intergenic
1075862118 10:125685734-125685756 TCCAACCAGAGCCAAAGCATGGG - Intergenic
1077281235 11:1747184-1747206 CTCACCCGGAGCCCAAGGGCAGG - Intronic
1081340979 11:41927284-41927306 TTCACTCAGAGCCAGAGCAATGG + Intergenic
1081472969 11:43393891-43393913 CTCACCAGGAACCAAATCACTGG - Intronic
1083490255 11:63010389-63010411 TTCACCTGGAGCCAACGCATCGG + Intronic
1087281602 11:96216894-96216916 TTCACCAGGAGACAAAGGGCAGG + Intronic
1089898956 11:121961469-121961491 TTCACCCAGAGAGAAAACACAGG - Intergenic
1091997152 12:5002578-5002600 TTCACCCTGTGCCAGAGCCCTGG + Intergenic
1094268674 12:28587431-28587453 TTCACCAGGAGCTAAAACCCTGG + Intergenic
1100433079 12:94547526-94547548 CTCACCTGGAGCAAAGGCACGGG - Intergenic
1101050356 12:100856705-100856727 TTCAGCCTGAGCAAAGGCACGGG + Intronic
1106389821 13:29324166-29324188 ATTACCCGGAGCCAAGCCACGGG - Intronic
1110080917 13:71309990-71310012 TTCACCCTCAGCTAAAGCAGAGG + Intergenic
1113838514 13:113345744-113345766 TTCACCCGGAGCCAAAGCACTGG + Intronic
1120661055 14:87251449-87251471 TTTACCTGAAGCCAAAGCACAGG - Intergenic
1121552760 14:94814776-94814798 TCCACCCGCCCCCAAAGCACAGG + Intergenic
1121714318 14:96062091-96062113 TTCAACATGAGCCAAAGGACCGG - Intronic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1122232949 14:100316181-100316203 CTCACCTGGATCCAAGGCACAGG - Intergenic
1126192570 15:45893683-45893705 TTCCCTTGGATCCAAAGCACTGG + Intergenic
1132319635 15:100916769-100916791 TTCACACTCAGGCAAAGCACTGG - Intergenic
1136689691 16:32020301-32020323 GTCACCCTGAACTAAAGCACAGG + Intergenic
1136879539 16:33890069-33890091 GTCACCCTGAACTAAAGCACAGG - Intergenic
1139465987 16:67154484-67154506 TTCCCCAGGAGCCAGACCACTGG - Exonic
1140922706 16:79553553-79553575 CTCACCCGGAGCCTGTGCACTGG + Intergenic
1142247985 16:88978498-88978520 CCCACCCTGAGCCAGAGCACAGG - Intergenic
1203092480 16_KI270728v1_random:1225310-1225332 GTCACCCTGAACTAAAGCACAGG + Intergenic
1145165930 17:20613505-20613527 ATCTCCCGGAGCCTGAGCACGGG - Intergenic
1148553874 17:48566333-48566355 TTCCCCAGGAGACAAAGCAAGGG - Intronic
1148688064 17:49511874-49511896 TCCACCTGGAGCCAGAGGACAGG - Exonic
1151634612 17:75337184-75337206 TTCTGCCGGAGGCAAAACACAGG + Intronic
1151851472 17:76692892-76692914 TTCACCAGGTTCCAAAGAACTGG + Intronic
1152785286 17:82244830-82244852 ATCTGTCGGAGCCAAAGCACAGG + Exonic
1153325947 18:3820383-3820405 TTCATCAGGAACCAAAGAACTGG + Intronic
1159547189 18:69854285-69854307 TTTATCTGGAGTCAAAGCACTGG + Exonic
1161398811 19:4058765-4058787 TCCAGCCGGACCCAAAGCCCAGG + Intronic
1163297326 19:16420866-16420888 CCCGCCAGGAGCCAAAGCACTGG + Intronic
1165315477 19:35052830-35052852 TGCACCCAAAGCCAAAACACTGG + Intronic
1167390348 19:49190594-49190616 TTCACCCGGAGACATGGCAGAGG - Intronic
1167843304 19:52139575-52139597 TTCGCCCGGGGCCGAAGCAGGGG + Intronic
925486162 2:4334157-4334179 TTCACTTGTATCCAAAGCACAGG - Intergenic
926456926 2:13078240-13078262 TTCACCCTGAGCTGAAGCAGAGG + Intergenic
926656319 2:15411010-15411032 TTCAGCCTGAGCTAAGGCACTGG + Intronic
928601553 2:32908692-32908714 TTCACCAGCAGCCAATCCACTGG + Intergenic
928940076 2:36718558-36718580 TTCTCCTGGAGCCAAAGAAAAGG + Intronic
933209045 2:79544802-79544824 TTCACCCAGAGCTCAAGCAAGGG - Intronic
934716495 2:96547570-96547592 TTCACCTGGAGGCGGAGCACAGG - Intronic
939107193 2:137963071-137963093 TTCCCCCGGGGTAAAAGCACTGG + Intergenic
1174254215 20:49242256-49242278 TTCTCCCTGACCCAAAGCACAGG - Intronic
1178146863 21:29750389-29750411 ATCACCCTGAGCCAGAGCTCTGG + Intronic
1180214988 21:46318159-46318181 CTCAGCAGGAGCCCAAGCACCGG + Exonic
1182637357 22:31738906-31738928 TTCACCCTGACACAAATCACAGG + Exonic
1184401744 22:44278582-44278604 TTCACCCGGAGCCAGCACACAGG - Intronic
953901747 3:46847431-46847453 TTCCCCTGGGCCCAAAGCACAGG + Intergenic
955492575 3:59498164-59498186 GTCACCCTGCGCCATAGCACTGG - Intergenic
962703266 3:138019486-138019508 TTCACCAGCAGCCAAAGGCCTGG - Intronic
964632075 3:158822015-158822037 TCCACCAGGAGCCCAAACACCGG - Exonic
965701074 3:171459957-171459979 TTCACCCTAACCCAAACCACTGG + Intronic
968920712 4:3521073-3521095 GTCACACAGAGCCACAGCACAGG - Intronic
976233940 4:82875726-82875748 GACACCAGGAGCCAAAACACAGG - Exonic
980107450 4:128601225-128601247 TTCTCCCCCAGCAAAAGCACCGG - Intergenic
987009893 5:13751802-13751824 TTCAACCTGTGCCAAAGCAGGGG + Intronic
988505236 5:31816744-31816766 TTCAACCAAAACCAAAGCACAGG + Intronic
988811732 5:34791936-34791958 CCAACCAGGAGCCAAAGCACAGG + Intronic
991562410 5:67967852-67967874 TTCCCTTGGAGCAAAAGCACCGG - Intergenic
995059303 5:107796243-107796265 TTCACTCAGAGCCAAAGGCCAGG - Intergenic
1005916862 6:30359918-30359940 TCCACCTGGAGCCATAGCTCAGG + Intergenic
1006294024 6:33161836-33161858 TTCACCCCGAGCCCGAGCCCGGG - Intergenic
1021904574 7:25320560-25320582 TTCACCTGGAGCCTTGGCACTGG - Intergenic
1022245672 7:28556885-28556907 TTGACCAGGAGCCACAGCTCTGG + Intronic
1028649785 7:93138728-93138750 TGCACCCAGAGCCAGGGCACTGG + Intronic
1029309813 7:99652582-99652604 TTCACCATGACCCAAAGTACTGG - Exonic
1029321214 7:99762070-99762092 TTCACCGTGACCCAAAGTACTGG - Exonic
1029331702 7:99861788-99861810 TTCACCATGACCCAAAGTACTGG + Exonic
1029989724 7:104952219-104952241 CTCACCCAGAACCAAATCACTGG - Intergenic
1030642652 7:112023493-112023515 TTCTCACGGAGCAAAAGCTCAGG + Intronic
1032738769 7:134717627-134717649 TGGACCCGGAGCCTGAGCACAGG - Intergenic
1035777829 8:2203238-2203260 TGCAGCCGGAGCCAAAGATCTGG - Intergenic
1038271234 8:26077866-26077888 TTCACTCGGAGCCACAGAGCAGG - Intergenic
1040323445 8:46329669-46329691 TTCACCCTGGGCCAGAGCCCGGG + Intergenic
1046798663 8:118399752-118399774 TTCATGGGGAACCAAAGCACTGG + Intronic
1049561916 8:143316335-143316357 TTCACGTGGGGCCACAGCACAGG + Intronic
1050116740 9:2271214-2271236 TTCACCTGCAGCCACAGTACTGG + Intergenic
1050693728 9:8257071-8257093 TTGACCGGGAGCCAAAGAATTGG + Intergenic
1050879607 9:10682245-10682267 TGCACCCCCAGTCAAAGCACAGG - Intergenic
1051420765 9:16887018-16887040 TTCACCCTGTACCAAACCACAGG - Intergenic
1058598491 9:106643032-106643054 TTCAACCAGTGCCTAAGCACTGG - Intergenic
1200002360 X:153068636-153068658 TTCAGCTGGCCCCAAAGCACAGG - Intergenic
1200005364 X:153081374-153081396 TTCAGCTGGCCCCAAAGCACAGG + Intergenic