ID: 1113840547

View in Genome Browser
Species Human (GRCh38)
Location 13:113357468-113357490
Sequence CTCTTAAGAAACCCTCTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113840544_1113840547 7 Left 1113840544 13:113357438-113357460 CCTCAAAAAAAAAAAAAAAAAAA 0: 5644
1: 19016
2: 22217
3: 49735
4: 178307
Right 1113840547 13:113357468-113357490 CTCTTAAGAAACCCTCTTTCTGG 0: 1
1: 0
2: 1
3: 9
4: 147
1113840543_1113840547 28 Left 1113840543 13:113357417-113357439 CCTGGCGACAGAGTGACACTGCC 0: 1
1: 5
2: 126
3: 1744
4: 7378
Right 1113840547 13:113357468-113357490 CTCTTAAGAAACCCTCTTTCTGG 0: 1
1: 0
2: 1
3: 9
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113840547 Original CRISPR CTCTTAAGAAACCCTCTTTC TGG Intronic
900897967 1:5497048-5497070 AACTTCAAAAACCCTCTTTCAGG + Intergenic
904818927 1:33227790-33227812 CTCTCAAGAGTCCCTCATTCAGG + Intergenic
906360256 1:45150731-45150753 CTCTCAAGAAACTCACTATCTGG - Intronic
907338882 1:53719394-53719416 CTCTGAAGAAATCCTCTCTGTGG + Intronic
910117628 1:83749811-83749833 CTGTTAAGAAATTCTCTTTCGGG - Intergenic
912177582 1:107179098-107179120 CTCTAAAGAGCCCATCTTTCAGG - Intronic
913287890 1:117243625-117243647 CTTTTGAAAAACTCTCTTTCTGG + Intergenic
914461992 1:147893474-147893496 CTCTTAAGAAACGTACTTGCTGG - Intergenic
920348554 1:205322346-205322368 CGCCTAAGAAGCCCTCTTTGAGG - Intergenic
923314375 1:232765671-232765693 CTCTTAAGTAACTCACTTACTGG + Intergenic
1062968302 10:1626942-1626964 CTCCTAAGAATCCCTCTCTGTGG + Intronic
1067393356 10:45886832-45886854 CTCTTAAGAAACTCTTAATCAGG - Intergenic
1067861679 10:49855962-49855984 CTCTTAAGAAACTCTTAATCAGG - Intronic
1068691890 10:59925005-59925027 CTCTGAAGAATCACTATTTCAGG + Intergenic
1070307833 10:75250402-75250424 CTCTAAACAGCCCCTCTTTCGGG + Intergenic
1071906334 10:90178251-90178273 CTTTTTTGAAACCCTCTTTGAGG + Intergenic
1071980510 10:91000328-91000350 CCCTTCAGAGAGCCTCTTTCAGG - Intergenic
1074753251 10:116606855-116606877 CTCTTAAGAAAGAGTCTTTCTGG - Intronic
1078828514 11:14955030-14955052 CTCTAAAGCAACCCTGTTTGTGG + Intronic
1081986126 11:47305732-47305754 CTGCTAAGATACCCTCTTCCTGG - Intronic
1083446495 11:62711099-62711121 TTTTTAAGAAAGCCTCTTTTTGG + Intronic
1086235239 11:84622303-84622325 CTATCAAGAAAGACTCTTTCTGG - Intronic
1087079510 11:94156320-94156342 AGATTAAGAAACCCTCTTTCTGG + Intronic
1088189506 11:107212148-107212170 TTCTTAAGACACCCTTTTTGGGG + Intergenic
1090477836 11:127039582-127039604 CTGTTGAAAAACCCTCTCTCTGG + Intergenic
1090746575 11:129710345-129710367 CTCTGAAGAAATCCACTCTCCGG - Intergenic
1091521504 12:1248820-1248842 CTCTTAAGAAGCTCACATTCTGG + Intronic
1092497128 12:9007665-9007687 CTCTTCAGCAACCATCTTTCAGG + Intronic
1094423530 12:30296559-30296581 CTCTTAGGAAACCCTCTCATGGG - Intergenic
1094502816 12:31036024-31036046 CTCTGCAGAGACCCTCTTCCTGG + Intergenic
1094546826 12:31412246-31412268 CTATCAAGAAACCCTCTTCGAGG - Intronic
1095076353 12:37932328-37932350 TTTCTAAGAAACCTTCTTTCTGG + Intergenic
1095139388 12:38642938-38642960 CTCTCAAGAAACCATATTTTTGG - Intergenic
1100462633 12:94816209-94816231 GCCTTAAGAAACCCACATTCGGG + Intergenic
1101184535 12:102260874-102260896 CACTTAAGAAATACCCTTTCTGG + Intergenic
1103158728 12:118709462-118709484 CTCTTAAGAAACACTGTTTTTGG - Intergenic
1104062418 12:125279781-125279803 GTCTTGAGAAACCCTCTAACAGG + Intronic
1105165221 13:17499586-17499608 CACGTTTGAAACCCTCTTTCTGG + Intergenic
1106091899 13:26603525-26603547 CAGTTAAGAAAACCTCTTTTGGG + Intronic
1110821207 13:79918997-79919019 CTCTGGAGAAACACACTTTCTGG - Intergenic
1111801669 13:92988788-92988810 CTGGTAAGGCACCCTCTTTCTGG + Intergenic
1113077526 13:106481882-106481904 CTCTTAACATATCCTCTTACTGG + Intergenic
1113840547 13:113357468-113357490 CTCTTAAGAAACCCTCTTTCTGG + Intronic
1114794827 14:25701711-25701733 CTCTTAAGAAACTCACTGACTGG - Intergenic
1117925427 14:60774201-60774223 CTCTTTAGAAAGACTCTTACTGG - Intronic
1118211144 14:63766766-63766788 CTCTAAAGAAAACCTCTCTGGGG + Intergenic
1118447005 14:65861222-65861244 CTCTAAAGAACCTCTTTTTCAGG - Intergenic
1120944974 14:89986044-89986066 CTTTTAAGAAAGCCACTTTAGGG - Intronic
1124574415 15:30895577-30895599 CCCTTAAGAGACCCTGTTTGGGG + Intergenic
1124829788 15:33137133-33137155 CTCTTAAAAATCCCTGTTTGGGG - Intronic
1125571173 15:40719357-40719379 CTCTAAAGAATGCCTTTTTCTGG - Intronic
1126376542 15:48002517-48002539 CTCTTCAGAAGCCCACCTTCTGG + Intergenic
1127069381 15:55273496-55273518 ATCTAAAGCAACTCTCTTTCAGG - Intronic
1128081142 15:64857615-64857637 CTCCTAAGGAACCCTGTATCTGG - Intronic
1128169142 15:65495303-65495325 CTCTTATAAAACCCTATGTCTGG + Intronic
1129747566 15:78035239-78035261 TCGTTAAGAAAACCTCTTTCCGG + Intronic
1133910931 16:10065960-10065982 CTCTCAAGGAACACTCTTTAAGG - Intronic
1135431004 16:22383273-22383295 CTTTTAAAAATCTCTCTTTCCGG - Intronic
1135504251 16:23022396-23022418 CTCTTCAGAGACCCTCTGTGGGG - Intergenic
1135855283 16:26004148-26004170 GCCTTAAGAAAACCTTTTTCAGG - Intronic
1138014285 16:53414573-53414595 CCCTTAAGAGACCCGGTTTCGGG - Intergenic
1138255520 16:55555651-55555673 CTGTTAAGCAACCTTCTTTTAGG + Intronic
1144248903 17:13396083-13396105 CTATTAAGAAACTGTCTTGCAGG - Intergenic
1144256058 17:13469879-13469901 TTCTTCAGAAACCCTGTGTCTGG - Intergenic
1150519141 17:65848256-65848278 ATCTTTTGAAACCCTGTTTCTGG + Intronic
1151078886 17:71305219-71305241 CTCTCAAGAAACCCCATTCCTGG + Intergenic
1153360971 18:4196704-4196726 CTTTTAAGTAACCTTATTTCTGG + Intronic
1153796954 18:8632424-8632446 CTCTTGAGAATGCCTCTGTCTGG - Intronic
1154174909 18:12079930-12079952 CAATTAAGAATCCCTTTTTCAGG - Intergenic
1155253772 18:23976720-23976742 ATCATAACAAACACTCTTTCAGG - Intergenic
1155311345 18:24527029-24527051 AGCTTATGAAACACTCTTTCTGG + Intergenic
1157199998 18:45651955-45651977 CTCTGAAGGGACTCTCTTTCTGG + Intronic
1159750746 18:72299139-72299161 CACATAATAAACCCTCTTTCTGG - Intergenic
1159848137 18:73490948-73490970 TTCTTTACAAATCCTCTTTCAGG + Intergenic
1162426815 19:10602280-10602302 CTCTCAAGTAACCCTCTTGAGGG - Intergenic
1164407411 19:27963700-27963722 CTCATAAGAAACCTTTTTTTGGG - Intergenic
926911033 2:17852552-17852574 CCCTTAAGAAAGCCTCTGTAAGG + Intergenic
928775976 2:34764293-34764315 CCCTAAAGAAAACCTCTGTCAGG - Intergenic
929288573 2:40163953-40163975 CTCTTTTGAAACCTTCATTCTGG + Intronic
930176412 2:48305534-48305556 TTGTTAAGAAACACTTTTTCTGG - Intergenic
932846470 2:75140599-75140621 CCCTTAAGAAGCCCTCCTTGAGG + Intronic
934565565 2:95338503-95338525 CTTTTAGGAAACCATCTTTATGG - Intronic
935110300 2:100087024-100087046 CTCTATAGAATCCCTCATTCAGG - Intronic
936124675 2:109778179-109778201 CTCTATAGAATCCCTCATTCAGG + Intergenic
936220014 2:110593287-110593309 CTCTATAGAATCCCTCATTCAGG - Intergenic
939789480 2:146553718-146553740 CTCTTAACTAAACCTCTATCAGG - Intergenic
940102523 2:150057948-150057970 CTTTTAAGAAAGCATTTTTCTGG + Intergenic
942449316 2:176099257-176099279 CTCTGGAGAAACCCTCTCTGTGG + Intergenic
944190290 2:196995940-196995962 TTGTGAAGAAACCCTATTTCAGG + Intronic
944755041 2:202752614-202752636 TTCTTTGGAAAACCTCTTTCAGG - Intronic
948123932 2:235551072-235551094 CTCTTAAGAAACACTATCTATGG - Intronic
1176406790 21:6373497-6373519 TGCTGGAGAAACCCTCTTTCTGG - Intergenic
1178757998 21:35371093-35371115 CTATTTAGAAACCCTGGTTCAGG + Intronic
1180700495 22:17778925-17778947 CTCTAAAGAAACCCTCATTCGGG - Intergenic
1183856021 22:40635940-40635962 CTCCTAAGAAAGCGTCTGTCAGG - Intronic
1185408974 22:50672956-50672978 CTCATCAGAAACACTCTGTCAGG + Intergenic
949876354 3:8628401-8628423 CTTTTCAGAAACCTTCATTCAGG - Intronic
957154687 3:76533057-76533079 CTCTGATGAAATCCTCTTTTAGG - Intronic
962552537 3:136510037-136510059 CTCTTAAAAAACAATTTTTCTGG + Intronic
963652154 3:147993528-147993550 CTGAAAAGAAACCATCTTTCAGG - Intergenic
964883015 3:161445477-161445499 GTGTTAAGGACCCCTCTTTCTGG + Intergenic
965518040 3:169643376-169643398 TTCTAAAGAAACCCTCTTACAGG + Intronic
967897420 3:194409559-194409581 CTATAAAGCAACCCTGTTTCAGG - Intronic
969081232 4:4619920-4619942 CTCTCAAGAAACTCTTTTTGGGG - Intergenic
969473938 4:7410310-7410332 CTCTGAAGTCCCCCTCTTTCTGG - Intronic
969749717 4:9100878-9100900 ATCTAAAGAAAGCATCTTTCAGG - Intergenic
971119953 4:23692373-23692395 CTCTTAACAAAAACTCTTTGTGG - Intergenic
971625541 4:28915573-28915595 TTCTTAAGAAACCCACTATTAGG - Intergenic
971887773 4:32475049-32475071 CTCTTAAACAACCCTGTTTATGG - Intergenic
974575276 4:63711615-63711637 ATTTTAAGTAACCCTCTTTGTGG + Intergenic
974847902 4:67373422-67373444 CCCATAGGAAACACTCTTTCAGG - Intergenic
977593099 4:98848750-98848772 CTCTTGAGATTCCCTCTTTGGGG + Intergenic
980039243 4:127920255-127920277 TTCTTACAGAACCCTCTTTCTGG + Exonic
981880751 4:149608951-149608973 CTTTTAAGATACCATCTTTTTGG - Intergenic
982443548 4:155463893-155463915 ATCTTAACAAACCCTGTTCCTGG + Intergenic
983106969 4:163698947-163698969 CACTTCAGAAAACCTCCTTCAGG + Intronic
983161727 4:164425071-164425093 CTCTAAATAACTCCTCTTTCTGG + Intergenic
983746751 4:171210238-171210260 TTTCTAATAAACCCTCTTTCTGG - Intergenic
988454578 5:31375798-31375820 CACTTAAGAAACCCTGCCTCAGG - Intergenic
990820935 5:59839508-59839530 CTCTCAAGAAAGACACTTTCAGG + Intronic
993534442 5:89065116-89065138 CACTTAAAAAATCCTCTTTTTGG + Intergenic
993680597 5:90873250-90873272 CTATTCAGATACCATCTTTCGGG + Intronic
993913357 5:93711032-93711054 CACTTAAGAAACCTTCAATCTGG + Intronic
994607137 5:101982273-101982295 CTCTTCAGTGACCCTTTTTCTGG - Intergenic
995542222 5:113196494-113196516 CACTTAAAAATCCCTATTTCTGG - Intronic
997284604 5:132669164-132669186 CTGTTAACAGACCCCCTTTCTGG + Intergenic
999383449 5:151137939-151137961 CTCTTCAGAAACTATCTTTTTGG + Intronic
1001022252 5:168193085-168193107 CTCTAAAGCAACTTTCTTTCAGG - Intronic
1005160341 6:22853099-22853121 ATCCTAACAACCCCTCTTTCAGG - Intergenic
1005853924 6:29845938-29845960 ATTTTAAGATAACCTCTTTCTGG + Intergenic
1007046854 6:38784206-38784228 CTCTAAAGAAAGCCTGTTTATGG + Intronic
1011732304 6:90277673-90277695 CTCTTAAGAAACAGACTTACAGG + Intronic
1013865611 6:114692704-114692726 GTGTTAAGAAACCCACTCTCTGG - Intergenic
1015544921 6:134352076-134352098 CTCTTCTGAAAGCCTCTTCCTGG + Intergenic
1016738376 6:147505390-147505412 CTCTCAGGAAACCTGCTTTCTGG - Intergenic
1020252002 7:6476722-6476744 CTCTGAAGATACCCTCCCTCAGG + Intronic
1020323273 7:6955763-6955785 ATCTAAAGAAAGCATCTTTCAGG + Intergenic
1020861452 7:13496846-13496868 CTCTCAAGAAAACCTATTTTTGG - Intergenic
1029091370 7:98050963-98050985 ATCTTAAGAAACCCCCTTTTCGG - Intergenic
1032727284 7:134602451-134602473 CTCTTAAGAACCTCTTTTCCTGG + Intergenic
1035740410 8:1923988-1924010 CTGTTTAGAAACACTCTTTCAGG - Intronic
1041768892 8:61451606-61451628 CCCTTAAGAAATGCTCTTCCAGG + Intronic
1045744159 8:105397645-105397667 CTCTTATGAAACAATATTTCAGG - Intronic
1045993900 8:108340873-108340895 TTCTCAAGAAATCCTTTTTCTGG - Intronic
1047800010 8:128299007-128299029 CTCTCAAGAAACCTGCTTTTTGG - Intergenic
1050386230 9:5094008-5094030 ATCTTAAGAAACCCTGTTCTTGG - Intronic
1051676337 9:19562022-19562044 CTCTTCAGAAACCATTTTGCAGG - Intronic
1053937661 9:43182085-43182107 CTGTTTAGAAACACTCTTTTTGG + Intergenic
1055691147 9:78832115-78832137 CACTTAAAAAACCAGCTTTCTGG - Intergenic
1056932793 9:90892759-90892781 CTATTAGGAAACCGTTTTTCAGG - Intronic
1057928770 9:99175502-99175524 CTCTTGAGAAACCCTGCTTTAGG - Intergenic
1059594104 9:115697758-115697780 CTCTTAAGAAATCCTTATACTGG + Intergenic
1059852965 9:118364177-118364199 CTGCTATGAAACCCTCTTTGGGG + Intergenic
1187919891 X:24191404-24191426 CTCCTCAGGAACCCTCTTTGTGG - Intronic
1188017872 X:25124877-25124899 CTCTTAAGAAAGGCGATTTCAGG + Intergenic
1189488037 X:41447629-41447651 CTATTAGGAAACCCTTTGTCAGG - Exonic
1189663235 X:43326318-43326340 CTCTTGAGAAGTCCTCCTTCTGG + Intergenic
1195211412 X:102654683-102654705 CTGTTAAGACACCCTGGTTCTGG + Exonic