ID: 1113842804

View in Genome Browser
Species Human (GRCh38)
Location 13:113369953-113369975
Sequence GGAGGGTCCTGAATAGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113842804_1113842815 10 Left 1113842804 13:113369953-113369975 CCAGCCCCTATTCAGGACCCTCC No data
Right 1113842815 13:113369986-113370008 GACCACTGCTATCAGCCTCTGGG No data
1113842804_1113842814 9 Left 1113842804 13:113369953-113369975 CCAGCCCCTATTCAGGACCCTCC No data
Right 1113842814 13:113369985-113370007 GGACCACTGCTATCAGCCTCTGG No data
1113842804_1113842819 25 Left 1113842804 13:113369953-113369975 CCAGCCCCTATTCAGGACCCTCC No data
Right 1113842819 13:113370001-113370023 CCTCTGGGAGGTTGCCAGTGCGG No data
1113842804_1113842820 26 Left 1113842804 13:113369953-113369975 CCAGCCCCTATTCAGGACCCTCC No data
Right 1113842820 13:113370002-113370024 CTCTGGGAGGTTGCCAGTGCGGG No data
1113842804_1113842821 29 Left 1113842804 13:113369953-113369975 CCAGCCCCTATTCAGGACCCTCC No data
Right 1113842821 13:113370005-113370027 TGGGAGGTTGCCAGTGCGGGAGG No data
1113842804_1113842817 13 Left 1113842804 13:113369953-113369975 CCAGCCCCTATTCAGGACCCTCC No data
Right 1113842817 13:113369989-113370011 CACTGCTATCAGCCTCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113842804 Original CRISPR GGAGGGTCCTGAATAGGGGC TGG (reversed) Intergenic
No off target data available for this crispr