ID: 1113842807

View in Genome Browser
Species Human (GRCh38)
Location 13:113369959-113369981
Sequence AGATTGGGAGGGTCCTGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113842807_1113842819 19 Left 1113842807 13:113369959-113369981 CCTATTCAGGACCCTCCCAATCT No data
Right 1113842819 13:113370001-113370023 CCTCTGGGAGGTTGCCAGTGCGG No data
1113842807_1113842817 7 Left 1113842807 13:113369959-113369981 CCTATTCAGGACCCTCCCAATCT No data
Right 1113842817 13:113369989-113370011 CACTGCTATCAGCCTCTGGGAGG No data
1113842807_1113842815 4 Left 1113842807 13:113369959-113369981 CCTATTCAGGACCCTCCCAATCT No data
Right 1113842815 13:113369986-113370008 GACCACTGCTATCAGCCTCTGGG No data
1113842807_1113842820 20 Left 1113842807 13:113369959-113369981 CCTATTCAGGACCCTCCCAATCT No data
Right 1113842820 13:113370002-113370024 CTCTGGGAGGTTGCCAGTGCGGG No data
1113842807_1113842821 23 Left 1113842807 13:113369959-113369981 CCTATTCAGGACCCTCCCAATCT No data
Right 1113842821 13:113370005-113370027 TGGGAGGTTGCCAGTGCGGGAGG No data
1113842807_1113842814 3 Left 1113842807 13:113369959-113369981 CCTATTCAGGACCCTCCCAATCT No data
Right 1113842814 13:113369985-113370007 GGACCACTGCTATCAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113842807 Original CRISPR AGATTGGGAGGGTCCTGAAT AGG (reversed) Intergenic
No off target data available for this crispr