ID: 1113842812

View in Genome Browser
Species Human (GRCh38)
Location 13:113369974-113369996
Sequence TAGCAGTGGTCCCTGAGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113842812_1113842817 -8 Left 1113842812 13:113369974-113369996 CCCAATCTCAGGGACCACTGCTA No data
Right 1113842817 13:113369989-113370011 CACTGCTATCAGCCTCTGGGAGG No data
1113842812_1113842824 24 Left 1113842812 13:113369974-113369996 CCCAATCTCAGGGACCACTGCTA No data
Right 1113842824 13:113370021-113370043 CGGGAGGCCCACCTTAAGGATGG No data
1113842812_1113842821 8 Left 1113842812 13:113369974-113369996 CCCAATCTCAGGGACCACTGCTA No data
Right 1113842821 13:113370005-113370027 TGGGAGGTTGCCAGTGCGGGAGG No data
1113842812_1113842823 20 Left 1113842812 13:113369974-113369996 CCCAATCTCAGGGACCACTGCTA No data
Right 1113842823 13:113370017-113370039 AGTGCGGGAGGCCCACCTTAAGG No data
1113842812_1113842820 5 Left 1113842812 13:113369974-113369996 CCCAATCTCAGGGACCACTGCTA No data
Right 1113842820 13:113370002-113370024 CTCTGGGAGGTTGCCAGTGCGGG No data
1113842812_1113842819 4 Left 1113842812 13:113369974-113369996 CCCAATCTCAGGGACCACTGCTA No data
Right 1113842819 13:113370001-113370023 CCTCTGGGAGGTTGCCAGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113842812 Original CRISPR TAGCAGTGGTCCCTGAGATT GGG (reversed) Intergenic
No off target data available for this crispr