ID: 1113842813

View in Genome Browser
Species Human (GRCh38)
Location 13:113369975-113369997
Sequence ATAGCAGTGGTCCCTGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113842813_1113842821 7 Left 1113842813 13:113369975-113369997 CCAATCTCAGGGACCACTGCTAT No data
Right 1113842821 13:113370005-113370027 TGGGAGGTTGCCAGTGCGGGAGG No data
1113842813_1113842820 4 Left 1113842813 13:113369975-113369997 CCAATCTCAGGGACCACTGCTAT No data
Right 1113842820 13:113370002-113370024 CTCTGGGAGGTTGCCAGTGCGGG No data
1113842813_1113842817 -9 Left 1113842813 13:113369975-113369997 CCAATCTCAGGGACCACTGCTAT No data
Right 1113842817 13:113369989-113370011 CACTGCTATCAGCCTCTGGGAGG No data
1113842813_1113842819 3 Left 1113842813 13:113369975-113369997 CCAATCTCAGGGACCACTGCTAT No data
Right 1113842819 13:113370001-113370023 CCTCTGGGAGGTTGCCAGTGCGG No data
1113842813_1113842823 19 Left 1113842813 13:113369975-113369997 CCAATCTCAGGGACCACTGCTAT No data
Right 1113842823 13:113370017-113370039 AGTGCGGGAGGCCCACCTTAAGG No data
1113842813_1113842824 23 Left 1113842813 13:113369975-113369997 CCAATCTCAGGGACCACTGCTAT No data
Right 1113842824 13:113370021-113370043 CGGGAGGCCCACCTTAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113842813 Original CRISPR ATAGCAGTGGTCCCTGAGAT TGG (reversed) Intergenic
No off target data available for this crispr