ID: 1113842820

View in Genome Browser
Species Human (GRCh38)
Location 13:113370002-113370024
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113842807_1113842820 20 Left 1113842807 13:113369959-113369981 CCTATTCAGGACCCTCCCAATCT No data
Right 1113842820 13:113370002-113370024 CTCTGGGAGGTTGCCAGTGCGGG No data
1113842805_1113842820 22 Left 1113842805 13:113369957-113369979 CCCCTATTCAGGACCCTCCCAAT No data
Right 1113842820 13:113370002-113370024 CTCTGGGAGGTTGCCAGTGCGGG No data
1113842810_1113842820 9 Left 1113842810 13:113369970-113369992 CCCTCCCAATCTCAGGGACCACT No data
Right 1113842820 13:113370002-113370024 CTCTGGGAGGTTGCCAGTGCGGG No data
1113842803_1113842820 27 Left 1113842803 13:113369952-113369974 CCCAGCCCCTATTCAGGACCCTC No data
Right 1113842820 13:113370002-113370024 CTCTGGGAGGTTGCCAGTGCGGG No data
1113842812_1113842820 5 Left 1113842812 13:113369974-113369996 CCCAATCTCAGGGACCACTGCTA No data
Right 1113842820 13:113370002-113370024 CTCTGGGAGGTTGCCAGTGCGGG No data
1113842813_1113842820 4 Left 1113842813 13:113369975-113369997 CCAATCTCAGGGACCACTGCTAT No data
Right 1113842820 13:113370002-113370024 CTCTGGGAGGTTGCCAGTGCGGG No data
1113842816_1113842820 -9 Left 1113842816 13:113369988-113370010 CCACTGCTATCAGCCTCTGGGAG No data
Right 1113842820 13:113370002-113370024 CTCTGGGAGGTTGCCAGTGCGGG No data
1113842811_1113842820 8 Left 1113842811 13:113369971-113369993 CCTCCCAATCTCAGGGACCACTG No data
Right 1113842820 13:113370002-113370024 CTCTGGGAGGTTGCCAGTGCGGG No data
1113842804_1113842820 26 Left 1113842804 13:113369953-113369975 CCAGCCCCTATTCAGGACCCTCC No data
Right 1113842820 13:113370002-113370024 CTCTGGGAGGTTGCCAGTGCGGG No data
1113842806_1113842820 21 Left 1113842806 13:113369958-113369980 CCCTATTCAGGACCCTCCCAATC No data
Right 1113842820 13:113370002-113370024 CTCTGGGAGGTTGCCAGTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113842820 Original CRISPR CTCTGGGAGGTTGCCAGTGC GGG Intergenic
No off target data available for this crispr