ID: 1113842829

View in Genome Browser
Species Human (GRCh38)
Location 13:113370032-113370054
Sequence CCTTAAGGATGGTCACCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113842822_1113842829 -6 Left 1113842822 13:113370015-113370037 CCAGTGCGGGAGGCCCACCTTAA No data
Right 1113842829 13:113370032-113370054 CCTTAAGGATGGTCACCTCAGGG No data
1113842816_1113842829 21 Left 1113842816 13:113369988-113370010 CCACTGCTATCAGCCTCTGGGAG No data
Right 1113842829 13:113370032-113370054 CCTTAAGGATGGTCACCTCAGGG No data
1113842818_1113842829 8 Left 1113842818 13:113370001-113370023 CCTCTGGGAGGTTGCCAGTGCGG No data
Right 1113842829 13:113370032-113370054 CCTTAAGGATGGTCACCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113842829 Original CRISPR CCTTAAGGATGGTCACCTCA GGG Intergenic
No off target data available for this crispr