ID: 1113847042

View in Genome Browser
Species Human (GRCh38)
Location 13:113398164-113398186
Sequence ATCTTCTCCTAGAAGAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113847042_1113847051 29 Left 1113847042 13:113398164-113398186 CCTTTGTTCTTCTAGGAGAAGAT No data
Right 1113847051 13:113398216-113398238 GCACAGATGGGGCTTCTAGTAGG No data
1113847042_1113847048 16 Left 1113847042 13:113398164-113398186 CCTTTGTTCTTCTAGGAGAAGAT No data
Right 1113847048 13:113398203-113398225 GAGTTTGGGGTGTGCACAGATGG No data
1113847042_1113847047 3 Left 1113847042 13:113398164-113398186 CCTTTGTTCTTCTAGGAGAAGAT No data
Right 1113847047 13:113398190-113398212 TCGGCACTTTCACGAGTTTGGGG No data
1113847042_1113847045 1 Left 1113847042 13:113398164-113398186 CCTTTGTTCTTCTAGGAGAAGAT No data
Right 1113847045 13:113398188-113398210 CCTCGGCACTTTCACGAGTTTGG No data
1113847042_1113847049 17 Left 1113847042 13:113398164-113398186 CCTTTGTTCTTCTAGGAGAAGAT No data
Right 1113847049 13:113398204-113398226 AGTTTGGGGTGTGCACAGATGGG No data
1113847042_1113847050 18 Left 1113847042 13:113398164-113398186 CCTTTGTTCTTCTAGGAGAAGAT No data
Right 1113847050 13:113398205-113398227 GTTTGGGGTGTGCACAGATGGGG No data
1113847042_1113847046 2 Left 1113847042 13:113398164-113398186 CCTTTGTTCTTCTAGGAGAAGAT No data
Right 1113847046 13:113398189-113398211 CTCGGCACTTTCACGAGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113847042 Original CRISPR ATCTTCTCCTAGAAGAACAA AGG (reversed) Intergenic
No off target data available for this crispr