ID: 1113848683

View in Genome Browser
Species Human (GRCh38)
Location 13:113405929-113405951
Sequence TGTGGGGCGATGGCAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113848683_1113848690 -3 Left 1113848683 13:113405929-113405951 CCTGCAGCTGCCATCGCCCCACA No data
Right 1113848690 13:113405949-113405971 ACAGGCTTTCATACCTGGTTTGG No data
1113848683_1113848696 23 Left 1113848683 13:113405929-113405951 CCTGCAGCTGCCATCGCCCCACA No data
Right 1113848696 13:113405975-113405997 GTTCATTTAATGAGGACAGTGGG No data
1113848683_1113848694 15 Left 1113848683 13:113405929-113405951 CCTGCAGCTGCCATCGCCCCACA No data
Right 1113848694 13:113405967-113405989 TTTGGGTGGTTCATTTAATGAGG No data
1113848683_1113848691 -2 Left 1113848683 13:113405929-113405951 CCTGCAGCTGCCATCGCCCCACA No data
Right 1113848691 13:113405950-113405972 CAGGCTTTCATACCTGGTTTGGG No data
1113848683_1113848686 -8 Left 1113848683 13:113405929-113405951 CCTGCAGCTGCCATCGCCCCACA No data
Right 1113848686 13:113405944-113405966 GCCCCACAGGCTTTCATACCTGG No data
1113848683_1113848695 22 Left 1113848683 13:113405929-113405951 CCTGCAGCTGCCATCGCCCCACA No data
Right 1113848695 13:113405974-113405996 GGTTCATTTAATGAGGACAGTGG No data
1113848683_1113848692 1 Left 1113848683 13:113405929-113405951 CCTGCAGCTGCCATCGCCCCACA No data
Right 1113848692 13:113405953-113405975 GCTTTCATACCTGGTTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113848683 Original CRISPR TGTGGGGCGATGGCAGCTGC AGG (reversed) Intergenic
No off target data available for this crispr