ID: 1113849581

View in Genome Browser
Species Human (GRCh38)
Location 13:113410556-113410578
Sequence CAGGACGCACAGCTGCTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113849581_1113849588 21 Left 1113849581 13:113410556-113410578 CCAAGGAGCAGCTGTGCGTCCTG No data
Right 1113849588 13:113410600-113410622 TGAGTCATTGGAGCCCACCCAGG No data
1113849581_1113849585 9 Left 1113849581 13:113410556-113410578 CCAAGGAGCAGCTGTGCGTCCTG No data
Right 1113849585 13:113410588-113410610 ACGCCCTCGTTCTGAGTCATTGG No data
1113849581_1113849589 25 Left 1113849581 13:113410556-113410578 CCAAGGAGCAGCTGTGCGTCCTG No data
Right 1113849589 13:113410604-113410626 TCATTGGAGCCCACCCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113849581 Original CRISPR CAGGACGCACAGCTGCTCCT TGG (reversed) Intergenic
No off target data available for this crispr