ID: 1113852597

View in Genome Browser
Species Human (GRCh38)
Location 13:113426332-113426354
Sequence GGCACCGCGGGAGCCACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 180}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113852588_1113852597 -6 Left 1113852588 13:113426315-113426337 CCCACCTCCTGCTCCCTGGCACC 0: 1
1: 0
2: 6
3: 103
4: 823
Right 1113852597 13:113426332-113426354 GGCACCGCGGGAGCCACAGAGGG 0: 1
1: 0
2: 0
3: 17
4: 180
1113852580_1113852597 10 Left 1113852580 13:113426299-113426321 CCCCTGCCCGCCACACCCCACCT 0: 1
1: 0
2: 7
3: 119
4: 1171
Right 1113852597 13:113426332-113426354 GGCACCGCGGGAGCCACAGAGGG 0: 1
1: 0
2: 0
3: 17
4: 180
1113852578_1113852597 28 Left 1113852578 13:113426281-113426303 CCTGCCTTACGGTGAGCACCCCT 0: 1
1: 0
2: 1
3: 4
4: 55
Right 1113852597 13:113426332-113426354 GGCACCGCGGGAGCCACAGAGGG 0: 1
1: 0
2: 0
3: 17
4: 180
1113852587_1113852597 -5 Left 1113852587 13:113426314-113426336 CCCCACCTCCTGCTCCCTGGCAC 0: 1
1: 1
2: 12
3: 95
4: 788
Right 1113852597 13:113426332-113426354 GGCACCGCGGGAGCCACAGAGGG 0: 1
1: 0
2: 0
3: 17
4: 180
1113852585_1113852597 0 Left 1113852585 13:113426309-113426331 CCACACCCCACCTCCTGCTCCCT 0: 1
1: 2
2: 31
3: 334
4: 2115
Right 1113852597 13:113426332-113426354 GGCACCGCGGGAGCCACAGAGGG 0: 1
1: 0
2: 0
3: 17
4: 180
1113852582_1113852597 8 Left 1113852582 13:113426301-113426323 CCTGCCCGCCACACCCCACCTCC 0: 1
1: 1
2: 8
3: 190
4: 1592
Right 1113852597 13:113426332-113426354 GGCACCGCGGGAGCCACAGAGGG 0: 1
1: 0
2: 0
3: 17
4: 180
1113852590_1113852597 -10 Left 1113852590 13:113426319-113426341 CCTCCTGCTCCCTGGCACCGCGG 0: 1
1: 0
2: 3
3: 28
4: 371
Right 1113852597 13:113426332-113426354 GGCACCGCGGGAGCCACAGAGGG 0: 1
1: 0
2: 0
3: 17
4: 180
1113852581_1113852597 9 Left 1113852581 13:113426300-113426322 CCCTGCCCGCCACACCCCACCTC 0: 1
1: 0
2: 13
3: 111
4: 1103
Right 1113852597 13:113426332-113426354 GGCACCGCGGGAGCCACAGAGGG 0: 1
1: 0
2: 0
3: 17
4: 180
1113852579_1113852597 24 Left 1113852579 13:113426285-113426307 CCTTACGGTGAGCACCCCTGCCC 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1113852597 13:113426332-113426354 GGCACCGCGGGAGCCACAGAGGG 0: 1
1: 0
2: 0
3: 17
4: 180
1113852589_1113852597 -7 Left 1113852589 13:113426316-113426338 CCACCTCCTGCTCCCTGGCACCG 0: 1
1: 0
2: 6
3: 127
4: 1024
Right 1113852597 13:113426332-113426354 GGCACCGCGGGAGCCACAGAGGG 0: 1
1: 0
2: 0
3: 17
4: 180
1113852583_1113852597 4 Left 1113852583 13:113426305-113426327 CCCGCCACACCCCACCTCCTGCT 0: 1
1: 0
2: 16
3: 124
4: 1084
Right 1113852597 13:113426332-113426354 GGCACCGCGGGAGCCACAGAGGG 0: 1
1: 0
2: 0
3: 17
4: 180
1113852584_1113852597 3 Left 1113852584 13:113426306-113426328 CCGCCACACCCCACCTCCTGCTC 0: 1
1: 0
2: 28
3: 246
4: 2216
Right 1113852597 13:113426332-113426354 GGCACCGCGGGAGCCACAGAGGG 0: 1
1: 0
2: 0
3: 17
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113852597 Original CRISPR GGCACCGCGGGAGCCACAGA GGG Intronic