ID: 1113856108

View in Genome Browser
Species Human (GRCh38)
Location 13:113446235-113446257
Sequence TCTGGGGGGTTTGCAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 263}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113856108_1113856116 -1 Left 1113856108 13:113446235-113446257 CCTGCAGCTGCAAACCCCCCAGA 0: 1
1: 1
2: 1
3: 16
4: 263
Right 1113856116 13:113446257-113446279 AGAGAGTGCACAGGGCCCAGTGG 0: 1
1: 0
2: 5
3: 63
4: 376
1113856108_1113856121 29 Left 1113856108 13:113446235-113446257 CCTGCAGCTGCAAACCCCCCAGA 0: 1
1: 1
2: 1
3: 16
4: 263
Right 1113856121 13:113446287-113446309 CCTCCCAGAGAGAGCACTCAGGG 0: 1
1: 0
2: 2
3: 17
4: 187
1113856108_1113856119 28 Left 1113856108 13:113446235-113446257 CCTGCAGCTGCAAACCCCCCAGA 0: 1
1: 1
2: 1
3: 16
4: 263
Right 1113856119 13:113446286-113446308 ACCTCCCAGAGAGAGCACTCAGG 0: 1
1: 0
2: 1
3: 10
4: 188
1113856108_1113856111 -9 Left 1113856108 13:113446235-113446257 CCTGCAGCTGCAAACCCCCCAGA 0: 1
1: 1
2: 1
3: 16
4: 263
Right 1113856111 13:113446249-113446271 CCCCCCAGAGAGAGTGCACAGGG 0: 1
1: 0
2: 0
3: 16
4: 182
1113856108_1113856109 -10 Left 1113856108 13:113446235-113446257 CCTGCAGCTGCAAACCCCCCAGA 0: 1
1: 1
2: 1
3: 16
4: 263
Right 1113856109 13:113446248-113446270 ACCCCCCAGAGAGAGTGCACAGG 0: 1
1: 0
2: 1
3: 6
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113856108 Original CRISPR TCTGGGGGGTTTGCAGCTGC AGG (reversed) Intronic
900029350 1:359485-359507 TCCGGGGAGTTGGCAGCTTCAGG + Intergenic
900049950 1:588257-588279 TCCGGGGAGTTGGCAGCTTCAGG + Intergenic
900363730 1:2302033-2302055 TCTCAGGGGTTTCCAGCCGCAGG + Intronic
900858518 1:5205874-5205896 AATGGGGGTTTTGGAGCTGCAGG + Intergenic
900901278 1:5517995-5518017 TCTTGGGGGTTGGCAGGTGGAGG - Intergenic
900956649 1:5890066-5890088 TCTCAGGGGTCAGCAGCTGCTGG + Intronic
900979735 1:6039553-6039575 TCTGGGCAGTTGGAAGCTGCAGG - Intronic
901957787 1:12798870-12798892 TCTGGGGGTTCTGCAGTTACTGG + Intergenic
902831652 1:19017742-19017764 CCTGGGGAGGTTGAAGCTGCAGG + Intergenic
903026904 1:20435812-20435834 TCTGGGGCTCTTGCTGCTGCAGG - Intergenic
903617326 1:24670190-24670212 GCTGGGGGCTTTTTAGCTGCTGG - Exonic
904011934 1:27394868-27394890 TCTGGGGGGTGTGGAGCTGGGGG - Exonic
904385254 1:30137269-30137291 GCTGGGTGGTTCTCAGCTGCAGG + Intergenic
906310488 1:44750525-44750547 TTGCGGGAGTTTGCAGCTGCAGG - Exonic
912628812 1:111228798-111228820 GCTGGGGGGATTGCAGTTCCAGG + Intronic
913675657 1:121138005-121138027 TTTGGAGGCTTTGCAGCTGATGG + Intergenic
914027555 1:143925946-143925968 TTTGGAGGCTTTGCAGCTGATGG + Intergenic
921891065 1:220353811-220353833 TCTAGGGGGTTTTGAGCAGCGGG + Intergenic
924260968 1:242231174-242231196 TCTAGGAGGTTGGTAGCTGCCGG + Intronic
1065240126 10:23695728-23695750 ACTGGGGAGTTTGGAGCTGGGGG + Intronic
1069785891 10:70987722-70987744 GCTGGGGGGCTTGCTTCTGCCGG + Intergenic
1072657040 10:97337010-97337032 TCTGGTGAGTTTCCAGTTGCTGG + Intergenic
1072810260 10:98456126-98456148 TCTGGGATGGATGCAGCTGCAGG - Intergenic
1073205340 10:101766434-101766456 TCTAGGGGGTGTGCAGTTGGGGG - Intergenic
1075489806 10:122856916-122856938 TCTGGGGGGCTGGCAGCTTAGGG - Intronic
1076139470 10:128068130-128068152 CCTGGGGGCTTTGCAGCCGTCGG - Exonic
1076184149 10:128433604-128433626 TTTGGTGAGTTTGCAGCAGCAGG - Intergenic
1076828835 10:132983984-132984006 TCTGGGGGGCTCCCCGCTGCTGG + Intergenic
1077487971 11:2847846-2847868 TCTGGGGGGGCCGCCGCTGCCGG - Exonic
1077936531 11:6794011-6794033 TATGTGGGGTTGGCAGGTGCAGG - Intergenic
1078145303 11:8718250-8718272 TCTGGGGTGTTTGCAGCAGAGGG - Intronic
1080258819 11:30323329-30323351 TGAGGGGGATTTCCAGCTGCTGG + Intronic
1080331984 11:31149495-31149517 GCTGGGCGGGTTGCTGCTGCTGG - Intronic
1080403905 11:31961564-31961586 TCTTTGGGGTTGGCAGCTGGGGG + Intronic
1080743601 11:35087803-35087825 TCTGGTGGTTTTGAAGCTGTGGG - Intergenic
1081669504 11:44935166-44935188 TCTGTGGGGTTGGCAGGGGCAGG - Intronic
1081858039 11:46316295-46316317 TCTGGAGTTTCTGCAGCTGCTGG - Exonic
1082737796 11:56875651-56875673 TCTCGGGGTTTTGCATGTGCCGG - Intergenic
1082756599 11:57082974-57082996 TTTGGGGCGATTCCAGCTGCTGG - Intergenic
1083272671 11:61580242-61580264 TCTGGGGGGTGGGGAACTGCAGG - Intronic
1083364049 11:62130596-62130618 TCTGGGGGCTTGGCAGTGGCGGG + Intronic
1083414206 11:62514809-62514831 TCTGGGGGTTTTGGAGCTCAAGG - Intronic
1083892679 11:65604442-65604464 GCTGGGGGCAGTGCAGCTGCTGG + Intronic
1084064282 11:66694357-66694379 TCCTGGCGGTTTGCAGATGCTGG - Exonic
1084597058 11:70123242-70123264 TCGGGGGGCTGTGCAGCAGCAGG + Intronic
1084754916 11:71231952-71231974 TCTGGGTGGTTTGCAGTTTTTGG - Intronic
1084757863 11:71251051-71251073 TCTCGGGGGCTGGCAGCTGCTGG - Intronic
1084774707 11:71367857-71367879 TCTGGTGGTTCTGCTGCTGCTGG - Intergenic
1085274131 11:75287392-75287414 TAGGGGGCGTTAGCAGCTGCAGG + Intronic
1092105907 12:5921644-5921666 TGTGAGGGGTTTGCTGCTGCAGG - Intronic
1094470097 12:30795466-30795488 TCTGGGGGGTTGGAAGGGGCGGG + Intergenic
1094922924 12:35471443-35471465 TTTGGGGAATTTGCAGCTGGAGG + Intergenic
1094923907 12:35487407-35487429 TTTGGGGAATTTGCAGCTGGAGG + Intergenic
1094936694 12:35694386-35694408 TTTGGGGAATTTGCAGCTGGGGG + Intergenic
1094950205 12:35913499-35913521 TTTGGGGAATTTGCAGCTGGAGG + Intergenic
1094961568 12:36097267-36097289 TTTGGGGAATTTGCAGCTGGAGG + Intergenic
1094962636 12:36114592-36114614 TTTGGGGAATTTGCAGCTGGAGG + Intergenic
1094968191 12:36204285-36204307 TTTGGGGAATTTGCAGCTGGAGG + Intergenic
1094978162 12:36364607-36364629 TTTGGGGAATTTGCAGCTGGAGG + Intergenic
1094982480 12:36434944-36434966 TTTGGGGAATTTGCAGCTGGAGG + Intergenic
1094983065 12:36444455-36444477 TTTGGGGAATTTGCAGCTGGAGG + Intergenic
1094985575 12:36484897-36484919 TTTGGGGAATTTGCAGCTGGAGG + Intergenic
1094992031 12:36589870-36589892 TTTGGGGAATTTGCAGCTGGAGG + Intergenic
1094994771 12:36633687-36633709 TTTGGGGAATTTGCAGCTGGAGG + Intergenic
1095002732 12:36762596-36762618 TTTGGGGAATTTGCAGCTGGAGG + Intergenic
1095012632 12:36923500-36923522 TTTGGGGAATTTGCAGCTGGAGG + Intergenic
1101520030 12:105474128-105474150 TCTGTGGCATTTGAAGCTGCTGG + Intergenic
1103071925 12:117951584-117951606 TCTGGGGGGTCTGGAGTTGTTGG - Intronic
1103399961 12:120637145-120637167 ACTGGTGGGTTTGCAGCAGTGGG - Intergenic
1104464181 12:128977253-128977275 TCTGAGGAGTCTGGAGCTGCTGG - Intronic
1104898605 12:132176095-132176117 TCTGAGGGGGTGGGAGCTGCTGG - Intergenic
1105296739 13:19093965-19093987 TCTGGGGCATTTGCAGATTCTGG + Intergenic
1108284004 13:48887561-48887583 TCTGGGGGCTAGGCAGGTGCTGG + Intergenic
1110704451 13:78588716-78588738 ACTGGGGGTTTTGCATCAGCCGG - Intergenic
1113848683 13:113405929-113405951 TGTGGGGCGATGGCAGCTGCAGG - Intergenic
1113852551 13:113426183-113426205 TCTGTAGGGTGTGTAGCTGCAGG - Intronic
1113856039 13:113445983-113446005 TCTGGGGGGTGTGCAGCCTCAGG - Intronic
1113856050 13:113446021-113446043 TCTGTGGGGTTTGCAGCCGCTGG - Intronic
1113856090 13:113446161-113446183 TCTGGAGGGTTTGCAGCTGCGGG - Intronic
1113856108 13:113446235-113446257 TCTGGGGGGTTTGCAGCTGCAGG - Intronic
1114575304 14:23707363-23707385 CCTGAGTGGGTTGCAGCTGCCGG + Intergenic
1117100946 14:52346606-52346628 TCTGGGGGGTATGGAATTGCTGG - Intergenic
1117344565 14:54819655-54819677 TCTGGGAGGAATGCAGCTGGAGG - Intergenic
1118416398 14:65541452-65541474 TCGGAGGGGATTGCTGCTGCTGG + Intronic
1119179688 14:72597420-72597442 TCCTGGGGGTTTCCAGGTGCTGG - Intergenic
1119263144 14:73250092-73250114 TCTGTGTGGATGGCAGCTGCCGG + Exonic
1119441471 14:74631389-74631411 CCAGGGGGGTTGTCAGCTGCAGG + Intergenic
1119960406 14:78849355-78849377 ACTGGTGAGTTTCCAGCTGCTGG + Intronic
1121377965 14:93431106-93431128 GCTGCGGCGTTTGCGGCTGCTGG + Intronic
1122891571 14:104734497-104734519 TCTGGGGGGATTCCTGCTGATGG - Intronic
1122956766 14:105074829-105074851 CCTGGGGGGGTAGCAGCAGCAGG + Intergenic
1122971819 14:105155271-105155293 TCTGGGTGGCTTGCAGCCTCCGG + Intronic
1123033497 14:105462114-105462136 TCTCGGGGGGCTGCGGCTGCGGG + Intronic
1123774182 15:23562058-23562080 TCTGCGGCCCTTGCAGCTGCCGG + Intergenic
1124249562 15:28097871-28097893 GCTGGGGGGTTGGGAGCAGCTGG - Intronic
1124610487 15:31204605-31204627 TGTGGGGGGCTTGCCGCTGTAGG + Intergenic
1126048088 15:44663249-44663271 TCTGGGGCGTTTCCTGCAGCTGG + Intronic
1128649621 15:69401051-69401073 TCACGGGGGTTTCCACCTGCTGG + Intronic
1129525103 15:76208697-76208719 CCTGGGAGGTTTGCAGCTCTGGG + Intronic
1130285291 15:82549652-82549674 TTTGGGTGGTTTTCAGGTGCAGG - Exonic
1130688858 15:86062836-86062858 TCTGTGTGGTTTCCAGCTCCAGG - Intergenic
1130841011 15:87701310-87701332 TCTAGGGGGCTTGCAGCAGTGGG - Intergenic
1131058618 15:89391069-89391091 GCTGGAGGGATAGCAGCTGCTGG + Intergenic
1132415757 15:101617703-101617725 TCAGGGGTGTTTGCAGCTGGCGG + Intergenic
1132670113 16:1099056-1099078 TGTGGGTGGGTGGCAGCTGCAGG - Intergenic
1132881252 16:2162643-2162665 TCTGGGGGCGGTGCAGCAGCAGG - Intronic
1134004288 16:10807542-10807564 TCTGAGGGGTTGGAAGCTACTGG + Intronic
1134026399 16:10957152-10957174 TCTGGGTGGTTTGCAGCCCAAGG - Intronic
1138256430 16:55567260-55567282 TCTGGGAAGTTCTCAGCTGCGGG + Exonic
1138375205 16:56558632-56558654 TCTCCGGGGCTTGCGGCTGCTGG - Intergenic
1139288390 16:65835452-65835474 GCTGAGGGGTTTGCACCTGCTGG + Intergenic
1139853128 16:69962468-69962490 GCTGGTGGGTCTGCAGGTGCAGG - Intronic
1139882099 16:70185376-70185398 GCTGGTGGGTCTGCAGGTGCAGG - Intronic
1140151569 16:72372521-72372543 GCTGGGAGGTGTGCAGCAGCAGG - Intergenic
1140370409 16:74410128-74410150 GCTGGTGGGTCTGCAGGTGCAGG + Intronic
1141867031 16:86757417-86757439 GCTGGTGGGTTTGCGTCTGCGGG + Intergenic
1141943760 16:87296251-87296273 TCTGGGGTGCTTGCAGCGCCAGG - Intronic
1142139492 16:88466462-88466484 TCTGGGGTGTTTGCAGTGGGGGG + Intronic
1142889809 17:2935902-2935924 TCTGGCGGGTTTGCTCCAGCCGG + Intronic
1143671315 17:8397902-8397924 CCCAGGGGGTTGGCAGCTGCTGG + Intergenic
1144645651 17:16971910-16971932 GCTGTGGGCTTTGCACCTGCTGG + Intronic
1146657948 17:34645976-34645998 TCTCGAGGATCTGCAGCTGCTGG - Intergenic
1146891967 17:36512043-36512065 TCTGAGGGTTTTGAAGTTGCTGG - Intronic
1147662187 17:42122619-42122641 TCTGGGAGGAGAGCAGCTGCGGG + Exonic
1148225541 17:45895903-45895925 TCTTGGCGTTTTGCTGCTGCGGG + Intronic
1148561544 17:48609615-48609637 TCTTGGGGTTCTGCAGCAGCTGG + Intronic
1148846454 17:50532816-50532838 TCTGAGGGGTCTGCACCTCCTGG + Exonic
1149833715 17:59893501-59893523 TCTGCGGGGCTCGCAGGTGCAGG + Intronic
1150197660 17:63317634-63317656 TTTGGGGGCTTGGCAGCTGTTGG - Intronic
1152431262 17:80249307-80249329 CCTTAGGGGTTAGCAGCTGCCGG + Intronic
1152609850 17:81310149-81310171 TTGGGGGGGTGCGCAGCTGCTGG - Intergenic
1152950408 17:83227071-83227093 TCCGGGGAGTTGGCAGCTTCAGG - Intergenic
1153959402 18:10127813-10127835 TGTGAGGGGTCAGCAGCTGCTGG - Intergenic
1155197323 18:23487066-23487088 TCAGGAGGGTCTGCAGATGCTGG - Intergenic
1155245461 18:23904486-23904508 TTTGGGGGGATGTCAGCTGCTGG + Intronic
1156487772 18:37477475-37477497 CCTGGGTGGTTTGCAGGTGGTGG + Intronic
1156888426 18:42162576-42162598 TGTGGGTGGTCTGCTGCTGCAGG + Intergenic
1158256286 18:55552720-55552742 TCCGGGGGTTCTGCAGCTGTTGG - Intronic
1158872280 18:61699570-61699592 GCTGGGGGCTGTGCAGGTGCTGG + Intergenic
1160594594 18:79964839-79964861 TCTGGGGGGTTTTGAGGTCCTGG + Intronic
1161327443 19:3670584-3670606 ACTGGGGGGCTTGGAGCAGCAGG - Intronic
1162094558 19:8302776-8302798 TATGGGGTTATTGCAGCTGCTGG - Exonic
1163405109 19:17117120-17117142 TCTGGGGGTTTTACTGCTCCAGG + Intronic
1165977829 19:39692675-39692697 TCTGGAGAGTTTGCAGATCCTGG + Intergenic
1168283767 19:55320512-55320534 TTTGGGGGGATCGCCGCTGCAGG - Intronic
925658945 2:6182136-6182158 TGTGGAGAGTTTGCAGCTCCTGG + Intergenic
927458493 2:23277576-23277598 TCTGGGGCTTTTCCAGCTTCCGG - Intergenic
928188182 2:29134623-29134645 TCTGGGTGGTTTGCAGTTGTAGG + Intronic
929446043 2:42002200-42002222 TCTGGGCCGTTTCCACCTGCAGG - Intergenic
930762014 2:55048946-55048968 TCTGCCGGGGTTTCAGCTGCAGG - Intronic
932003301 2:67904667-67904689 TCTGGGGGATTGAGAGCTGCAGG + Intergenic
934851863 2:97706919-97706941 GCTGGGGGGAGGGCAGCTGCGGG + Intergenic
935649556 2:105370573-105370595 TGTGGGGGGTGTGGAGCTGGTGG + Intronic
936399014 2:112151765-112151787 TAGGAGGGGATTGCAGCTGCTGG + Intronic
938596023 2:132787991-132788013 CCTGGGAGGTTTGCAGCCACTGG - Intronic
939126083 2:138179050-138179072 TCTGGGTGATTTGCAATTGCTGG - Intergenic
942530034 2:176900162-176900184 CCTGGGGCTTTTGCAGCTCCAGG + Intergenic
945041167 2:205745011-205745033 TCTGGGGGCTAATCAGCTGCAGG + Intronic
945993136 2:216412967-216412989 TCTGGGGAGTTTGGAGGTGCAGG + Intronic
946204339 2:218092658-218092680 TCTCTGGGCTTTGCAGTTGCTGG - Intergenic
946228722 2:218278764-218278786 TCTGGGGAGGCTGCAGCTGACGG + Intronic
948673146 2:239581503-239581525 TCTGGGGCGTTTGTGCCTGCTGG + Intronic
948838178 2:240636331-240636353 ACAGGAGGGTTTCCAGCTGCAGG - Intergenic
1170030101 20:11935656-11935678 CTTGGGGGGTTTTCAGCTGCTGG + Intergenic
1171382664 20:24745368-24745390 GCTGGGGCCTTTGCAGATGCTGG - Intergenic
1172130668 20:32652734-32652756 TTTGGGGGGCTTCCTGCTGCTGG + Intergenic
1175547254 20:59786279-59786301 TCTGTGGGGCTGGCACCTGCTGG + Intronic
1177978782 21:27884983-27885005 CCTGAGAGGGTTGCAGCTGCTGG + Intergenic
1178272498 21:31204668-31204690 TCAGGAGTGTCTGCAGCTGCAGG + Intronic
1179984603 21:44913545-44913567 CCTGGGGGGCTTGGAGCTGGGGG + Intronic
1181107255 22:20582655-20582677 ACTGCGGGGTCTGCACCTGCTGG - Exonic
1181665528 22:24393385-24393407 CCAGGTGTGTTTGCAGCTGCAGG + Intronic
1181783099 22:25207202-25207224 TCTGGGTGCCTTTCAGCTGCTGG - Exonic
1182446127 22:30390610-30390632 TCTTGGGAGTTTGGATCTGCGGG - Intronic
1184330332 22:43823206-43823228 TCTTAGGGGTCTGCAGTTGCAGG - Intergenic
1184414950 22:44346843-44346865 TCAGGTGTGTCTGCAGCTGCTGG - Intergenic
1184762383 22:46551871-46551893 TCCAGGGGGCTTCCAGCTGCTGG - Intergenic
1185185828 22:49399225-49399247 TCTGAGAGATTTGCAGCTGTAGG - Intergenic
1185333409 22:50261517-50261539 TCTGCGGGGTGGGCAGCTCCCGG - Exonic
1185411503 22:50685341-50685363 TCTGGGAGAGTTGTAGCTGCCGG + Intergenic
1185411524 22:50685430-50685452 TCTGGGAGAGTTGTAGCTGCCGG + Intergenic
1185411559 22:50685578-50685600 TCTGGGAGAGTTGTAGCTGCCGG + Intergenic
1185411594 22:50685726-50685748 TCTGGGAGAGTTGTAGCTGCCGG + Intergenic
1185411628 22:50685874-50685896 TCTGGGAGAGTTGTAGCTGCCGG + Intergenic
1185411677 22:50686081-50686103 TCTGGGAGAGTTGTAGCTGCCGG + Intergenic
1185411766 22:50686465-50686487 TCTGGGAGAGTTGTAGCTGCCGG + Intergenic
1185411829 22:50686731-50686753 TCTGGGAGAGTTGTAGCTGCCGG + Intergenic
952428868 3:33202634-33202656 TCTGTGGGGTCTGCAGCTTGGGG - Intronic
952823352 3:37504184-37504206 TCTGGGGTGTTTGCTCCTGTAGG + Intronic
953387843 3:42516707-42516729 TCTGGGAATTTTGCTGCTGCTGG - Intronic
953465235 3:43114100-43114122 TTTGGGGGCATTGCAGCTACAGG - Intergenic
954361629 3:50125450-50125472 TTTGGGGGGTTGGGAGCTGAGGG + Intergenic
954925686 3:54232254-54232276 GCTTGGGGGTTTTCAGCTACAGG + Intronic
955325479 3:58006865-58006887 TGTGGGGAGGTTGAAGCTGCAGG + Intergenic
955406213 3:58627252-58627274 TCTGGGAGGTGAGGAGCTGCAGG - Exonic
956348820 3:68311735-68311757 TCTGTGGGTTTTTCAGGTGCAGG + Intronic
957156588 3:76551661-76551683 TCTTGGGGCTTTGCAGTTTCTGG + Intronic
959323450 3:104906960-104906982 CCTGAGTGGGTTGCAGCTGCTGG - Intergenic
961306352 3:125960818-125960840 TCTGGTGGGTCAGGAGCTGCAGG + Intergenic
961453166 3:127011667-127011689 TCTGGGGCCTTTTCAGCTGCTGG + Intronic
961828445 3:129611151-129611173 CCTGGAGGCTGTGCAGCTGCAGG - Intergenic
963788845 3:149562801-149562823 CCTGGGTGTTTTGCAGTTGCTGG - Intronic
964747018 3:160022173-160022195 CCTGGGGCGTTAGCAGCTGGAGG - Intronic
964863790 3:161231331-161231353 TTTGGAGGGTTTGCAGTTACTGG + Intronic
968585673 4:1414897-1414919 TCTGGGGGGAGGGCAGCTGCGGG - Intergenic
969316776 4:6386476-6386498 CCTGGCTGGGTTGCAGCTGCTGG - Intronic
971235632 4:24839645-24839667 CCTGGAAGGTTTGGAGCTGCAGG - Intronic
972313758 4:37906093-37906115 TCTGGATGGTCTGCTGCTGCAGG + Intronic
973570986 4:52239516-52239538 ACTTGGTGGTTTGCAGATGCTGG + Intergenic
981692884 4:147528892-147528914 ACTGGGGGGTTTGGAGCAGAGGG + Intronic
983069622 4:163253619-163253641 TTTGGGGGCTTTGCAGTTTCTGG - Intergenic
984324246 4:178231362-178231384 CCTGGGTGGGTTGCTGCTGCTGG - Intergenic
985150978 4:186946773-186946795 TCAGTGGGATCTGCAGCTGCTGG - Intergenic
985681628 5:1258816-1258838 CCAGGGTGGTTCGCAGCTGCCGG - Intronic
988100396 5:26669481-26669503 TCTGGGGGCTTTGCCCCCGCCGG + Intergenic
988417351 5:30962026-30962048 TCTGTGGTGTTTGCAGTTCCTGG - Intergenic
988619134 5:32804561-32804583 TCTGAGTGGGTTGCTGCTGCTGG + Intergenic
990185411 5:53205069-53205091 TCTTGGGTGTTTGTAGCTTCAGG - Intergenic
996780629 5:127182922-127182944 CCTGAGCGGTTTGCTGCTGCTGG - Intergenic
997528105 5:134566466-134566488 TCTTGGGGGTCAGCAGCGGCTGG - Exonic
999784610 5:154879934-154879956 TCTGGGGCAGTTGCAGCTACTGG - Intergenic
1001011865 5:168106060-168106082 TCTGGTGTGTTTTCTGCTGCAGG - Intronic
1001019788 5:168173224-168173246 TCCTTGGGTTTTGCAGCTGCCGG - Intronic
1001221696 5:169905733-169905755 CCTGGGTGGTTTGCAGTTCCTGG - Intronic
1002063928 5:176642910-176642932 GCTGGGGGCTTTTCAGATGCTGG + Intronic
1002744640 5:181460886-181460908 TCCGGGGAGTTGGCAGCTTCAGG - Intergenic
1005004902 6:21278279-21278301 TGAGGTTGGTTTGCAGCTGCAGG - Intergenic
1006217600 6:32458653-32458675 CCTGAGTGGGTTGCAGCTGCTGG + Intergenic
1006809385 6:36810238-36810260 CCTGGGGGCTTTGCAGCTGGGGG - Intronic
1007480795 6:42148574-42148596 TCTGGGGAGACTGCAGCTGTGGG - Intergenic
1009809219 6:68639368-68639390 CTTGGGTGGTTTGCAGCTCCTGG - Exonic
1010952340 6:82051739-82051761 TCTGTGGGTTTTGCATCTGTAGG - Intergenic
1013188733 6:107783986-107784008 TTAGGGGTGGTTGCAGCTGCAGG + Intronic
1013648770 6:112172199-112172221 TCTGGCTGGTCAGCAGCTGCAGG - Intronic
1017684904 6:156902769-156902791 TCTGTGGGGTTTGTAGCAGTAGG + Intronic
1018683679 6:166284942-166284964 TCTGAGGGGTTTGCTGAGGCCGG - Intergenic
1018953817 6:168394940-168394962 CCTGGGGGATTTGGAGCCGCTGG - Intergenic
1019122503 6:169814259-169814281 TCAGGGTGGTCTGCAGGTGCGGG - Intergenic
1019122514 6:169814298-169814320 TCAGGGTGGTCTGCAGGTGCGGG - Intergenic
1019122576 6:169814571-169814593 TCAGGGTGGTCTGCAGGTGCGGG - Intergenic
1019249551 6:170734427-170734449 TCCGGGGAGTTGGCAGCTTCAGG - Intergenic
1019395559 7:816267-816289 TGGGGGGGGTTTGCATCTGGGGG - Intergenic
1024054429 7:45650881-45650903 CCAGGTGGGTTTGCAGCTCCAGG - Intronic
1029257029 7:99276465-99276487 TTTGAGGGGCTTGCAGATGCAGG + Intergenic
1029513576 7:101012141-101012163 TCTGGGTGGTTAGCTGCTGGAGG + Intronic
1031898477 7:127382644-127382666 CCTGCAGGTTTTGCAGCTGCAGG - Intronic
1034720209 7:153285351-153285373 TCTTGTGGGTTAGCAGCCGCTGG + Intergenic
1035323745 7:158051441-158051463 TGTGAGGCCTTTGCAGCTGCTGG - Intronic
1035498545 8:73229-73251 TCCGGGGAGTTGGCAGCTTCAGG + Intronic
1036705536 8:11043531-11043553 TCCAGGGGCTCTGCAGCTGCTGG - Intronic
1037589932 8:20303920-20303942 GCTGGCGGGTTGGCAGCGGCCGG - Exonic
1037873586 8:22524195-22524217 TCTGGTGTGTTTGTAGCTGGTGG + Intronic
1039490043 8:37940597-37940619 TCTGGGGTTTTTGCTTCTGCAGG - Intergenic
1041255972 8:55979969-55979991 TCTGGAGGGCTGTCAGCTGCAGG - Intronic
1042187979 8:66155983-66156005 TCTGGAGGGTTTGCTCCTCCTGG - Intronic
1044629768 8:94266991-94267013 TCTGGGGAGGATGCAGCTGGAGG - Intergenic
1047665450 8:127086654-127086676 GCTGGGGGCTTTTTAGCTGCTGG + Intergenic
1047973273 8:130105129-130105151 TCTGGGAGTTCTGCATCTGCAGG + Intronic
1051866030 9:21683813-21683835 TCTGAGGATTTTGCAGATGCAGG + Intergenic
1052318176 9:27138230-27138252 TCTGAGCGGGTTGCCGCTGCTGG + Intronic
1052593622 9:30530972-30530994 TCTGGGGCTTTGGCAGTTGCAGG - Intergenic
1055695684 9:78881678-78881700 TCTGGTGGGTGTGTAGCTGCTGG + Intergenic
1056224549 9:84482504-84482526 CCTGGGTGATTTCCAGCTGCAGG + Intergenic
1057486497 9:95488906-95488928 CCTGAGGGCTTTGCAGTTGCTGG - Intronic
1058572478 9:106361889-106361911 TCTGGTAGTTTTGCAGCTTCAGG + Intergenic
1059277585 9:113109081-113109103 TCTGCGGGGTTCCCAGCAGCTGG - Intergenic
1059278666 9:113115470-113115492 TCTGCGGGGTTCCCAGCAGCTGG + Intergenic
1061869093 9:133510823-133510845 TCAGAGGTGTTTGCATCTGCAGG + Intergenic
1062132963 9:134910058-134910080 AATGTGGGGTTTGCAGATGCTGG + Intronic
1062206513 9:135340552-135340574 TTTGGGGGCAGTGCAGCTGCGGG - Intergenic
1062480279 9:136747863-136747885 TCTGGGGGGTTGGAAGCTGGAGG - Intronic
1203610451 Un_KI270748v1:91365-91387 TCCGGGGAGTTGGCAGCTTCAGG - Intergenic
1185825205 X:3243043-3243065 TGAGTGGGGGTTGCAGCTGCTGG - Intergenic
1188574390 X:31629303-31629325 TCCGGGGGCTTTGCTGCCGCTGG - Intronic
1188678081 X:32967575-32967597 TCTGATGGGTTTGCCACTGCGGG - Intronic
1189637354 X:43024839-43024861 TGTGGATGGTTTGCTGCTGCAGG + Intergenic
1192202328 X:69074419-69074441 TCTGGGGTTTTTTCAGCTGCAGG - Intergenic
1195432707 X:104807116-104807138 CCTTGGGGGTATGCAGCTGTGGG + Intronic
1196752352 X:119129332-119129354 ACTGGGGGGTTTGGAGCAGGGGG + Intronic
1198474608 X:136983426-136983448 GCTGGGGGCTTTTAAGCTGCTGG + Intergenic
1202360753 Y:24107690-24107712 TTTGGGGGCTTTGCAGTTTCTGG - Intergenic
1202510025 Y:25562428-25562450 TTTGGGGGCTTTGCAGTTTCTGG + Intergenic