ID: 1113859013

View in Genome Browser
Species Human (GRCh38)
Location 13:113468945-113468967
Sequence GGCTCGTCCTTACCTGGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 86}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113859013_1113859023 27 Left 1113859013 13:113468945-113468967 CCGGGACCAGGTAAGGACGAGCC 0: 1
1: 0
2: 1
3: 2
4: 86
Right 1113859023 13:113468995-113469017 GCCACCAACAGGGAAGTGCCTGG 0: 1
1: 0
2: 1
3: 15
4: 185
1113859013_1113859021 16 Left 1113859013 13:113468945-113468967 CCGGGACCAGGTAAGGACGAGCC 0: 1
1: 0
2: 1
3: 2
4: 86
Right 1113859021 13:113468984-113469006 TGAGGGCAGAGGCCACCAACAGG 0: 1
1: 0
2: 4
3: 29
4: 258
1113859013_1113859025 28 Left 1113859013 13:113468945-113468967 CCGGGACCAGGTAAGGACGAGCC 0: 1
1: 0
2: 1
3: 2
4: 86
Right 1113859025 13:113468996-113469018 CCACCAACAGGGAAGTGCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 155
1113859013_1113859018 -2 Left 1113859013 13:113468945-113468967 CCGGGACCAGGTAAGGACGAGCC 0: 1
1: 0
2: 1
3: 2
4: 86
Right 1113859018 13:113468966-113468988 CCTGAAGTAGGCTGTGGCTGAGG 0: 1
1: 0
2: 4
3: 52
4: 334
1113859013_1113859016 -8 Left 1113859013 13:113468945-113468967 CCGGGACCAGGTAAGGACGAGCC 0: 1
1: 0
2: 1
3: 2
4: 86
Right 1113859016 13:113468960-113468982 GACGAGCCTGAAGTAGGCTGTGG 0: 1
1: 0
2: 0
3: 10
4: 146
1113859013_1113859022 17 Left 1113859013 13:113468945-113468967 CCGGGACCAGGTAAGGACGAGCC 0: 1
1: 0
2: 1
3: 2
4: 86
Right 1113859022 13:113468985-113469007 GAGGGCAGAGGCCACCAACAGGG 0: 1
1: 0
2: 7
3: 28
4: 323
1113859013_1113859020 5 Left 1113859013 13:113468945-113468967 CCGGGACCAGGTAAGGACGAGCC 0: 1
1: 0
2: 1
3: 2
4: 86
Right 1113859020 13:113468973-113468995 TAGGCTGTGGCTGAGGGCAGAGG 0: 1
1: 0
2: 5
3: 81
4: 708
1113859013_1113859019 -1 Left 1113859013 13:113468945-113468967 CCGGGACCAGGTAAGGACGAGCC 0: 1
1: 0
2: 1
3: 2
4: 86
Right 1113859019 13:113468967-113468989 CTGAAGTAGGCTGTGGCTGAGGG 0: 1
1: 1
2: 5
3: 103
4: 719

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113859013 Original CRISPR GGCTCGTCCTTACCTGGTCC CGG (reversed) Intronic
900470827 1:2854142-2854164 ATCTCGTCCTCACCTGGCCCAGG + Intergenic
901150746 1:7099627-7099649 GGCTCTTCCTTACCTGGGGGAGG + Intronic
903259613 1:22124252-22124274 GCCTTGTCCTTTCCTGGGCCAGG + Intronic
904286536 1:29456281-29456303 GGCTGTTCCTGCCCTGGTCCAGG - Intergenic
905199539 1:36306746-36306768 GGCTCGGCCTCACCTGCACCAGG - Exonic
905408277 1:37752325-37752347 GCCACCTCCTTTCCTGGTCCCGG - Intronic
918118998 1:181521297-181521319 GGAGAGTCCTTACCTAGTCCAGG + Intronic
922779378 1:228239857-228239879 GGCTCTGCCCTGCCTGGTCCAGG + Intronic
1065963185 10:30750720-30750742 GGCTGGTCCTCACAGGGTCCTGG + Intergenic
1073575353 10:104618413-104618435 GGCTGGTCCTTAGCCGGTGCGGG + Intergenic
1078014932 11:7604850-7604872 GGCTCCTGCTCACATGGTCCTGG - Intronic
1085742568 11:79089512-79089534 GCCCAGTCCTTACCTGGACCTGG + Intronic
1088657492 11:112014537-112014559 GGCCCTTCCTGACCTGTTCCAGG + Intronic
1089351454 11:117823848-117823870 GGCCTGTCCTTTCCTGGCCCAGG - Intronic
1089599548 11:119605032-119605054 GGCTCTGCCTCTCCTGGTCCAGG - Intergenic
1090436474 11:126690689-126690711 GCCTTGTCCTTAGCTGGTTCAGG - Intronic
1093668372 12:21841774-21841796 GTCTGGGCCTTACCTAGTCCTGG - Intronic
1096523090 12:52195005-52195027 TTCTAGTCCTTACATGGTCCAGG + Intergenic
1104939983 12:132390495-132390517 GGGGCCTCCTTACCTGGGCCAGG + Intergenic
1111901338 13:94202817-94202839 GGCTCCTCCTCACCTACTCCCGG - Intronic
1113859013 13:113468945-113468967 GGCTCGTCCTTACCTGGTCCCGG - Intronic
1118337921 14:64870169-64870191 CCCTCTTCCTTACCAGGTCCTGG - Intronic
1119669843 14:76510062-76510084 GGGTGGTCCTTGCCTGGTCTTGG + Intergenic
1128866859 15:71120704-71120726 AGCTCGTCATGACCTGCTCCAGG + Intronic
1131261887 15:90891878-90891900 GGTTGGTGCTTACCTGGTCAGGG + Intronic
1133002007 16:2856509-2856531 TGCTGGTCCTCACCTGGCCCTGG + Intronic
1143367109 17:6415568-6415590 GGGGCGTCCTTCCCTGGGCCTGG - Intronic
1143582289 17:7834341-7834363 GGCTCCCCGTTACCTGGTTCTGG - Intergenic
1148744764 17:49912069-49912091 TGCACCTCCTTTCCTGGTCCAGG + Intergenic
1161577676 19:5063898-5063920 GGCTCGTCTTTAGCTGGCTCCGG + Intronic
1162592166 19:11599095-11599117 GCATCCTCCTTTCCTGGTCCTGG + Intronic
1165052498 19:33150929-33150951 GGCAGGTCGTTGCCTGGTCCGGG + Intronic
1165065119 19:33224341-33224363 GCCTGGTCCTGACCTGGCCCTGG - Intronic
1167521576 19:49958895-49958917 GCCTCTTCCTTCCCTAGTCCTGG - Exonic
1167523805 19:49971827-49971849 GCCTCTTCCTTCCCTAGTCCTGG + Intergenic
1167756256 19:51415433-51415455 GCCTCTTCCTTCCCTAGTCCTGG - Exonic
1167972607 19:53197850-53197872 GCCGCGTCCTTACTTGGTTCTGG + Intergenic
929927859 2:46230353-46230375 GGCTCCTGCTCACCTGGCCCTGG + Intergenic
935112175 2:100104318-100104340 CGCGCGTCCTCACCTGGGCCGGG - Intronic
936122802 2:109760833-109760855 CGCGCGTCCTCACCTGGGCCGGG + Intergenic
936221889 2:110610631-110610653 CGCGCGTCCTCACCTGGGCCGGG - Intergenic
944981358 2:205124362-205124384 GACTCTTCCATACATGGTCCCGG + Exonic
946346753 2:219117180-219117202 GGCTCGACCTGGCCTGGCCCAGG + Intronic
948923102 2:241075651-241075673 GGCTTGTCCTTCCCTGTTCTTGG + Intronic
1169217974 20:3804283-3804305 TGCTTCTCCTTTCCTGGTCCAGG + Intronic
1171442511 20:25176681-25176703 GGCTGGTGCTGACCTGGGCCTGG - Intergenic
1172756665 20:37289944-37289966 GGCTCCTCATGGCCTGGTCCGGG + Intronic
1174238161 20:49111232-49111254 GTCTTGTCCTTTCCTGGTCCAGG - Intergenic
1176229277 20:64023497-64023519 GGCCTGTCCTCACCTGGTACAGG - Intronic
1182740343 22:32562891-32562913 GGCTCTTCTTTCCCTTGTCCTGG - Intronic
1184472272 22:44702599-44702621 GGCGCGGCCTTACCTGTTCCAGG - Exonic
1185096784 22:48811916-48811938 GGCACGTCTTCACCTGCTCCTGG + Intronic
950459923 3:13115187-13115209 GGCTCTTCCCTACCTGGTCCTGG + Intergenic
951252375 3:20409126-20409148 GGCTAGTTCTTTCCTGGACCTGG + Intergenic
953457694 3:43055786-43055808 GGCTAGTCCTTCCCTTGTTCTGG + Intronic
953549165 3:43887243-43887265 GGCTGGCACTTACCTGGGCCAGG + Intergenic
960165815 3:114400161-114400183 GGCTGGTTCTTACCAGATCCAGG - Intronic
968595256 4:1479037-1479059 GTCCCGTCCTTACCTGGGCTAGG - Intergenic
969298257 4:6282021-6282043 TGCTCGTTCTTGCCTGGCCCAGG + Intronic
972642474 4:40938223-40938245 TGCTTGTCCTGACCTTGTCCAGG + Intronic
976587580 4:86816100-86816122 GGCCCCTCATTACTTGGTCCTGG + Intergenic
980423905 4:132600076-132600098 GGCTGGACCTTTCCTGCTCCAGG + Intergenic
986958900 5:13189923-13189945 GGCTTGTCCTTACCTGGGATGGG - Intergenic
992487744 5:77211469-77211491 GAAGCGTCCTTAGCTGGTCCTGG + Intronic
997657707 5:135567798-135567820 GGCTCGTCCTGAGCAGGCCCTGG - Intergenic
1007821454 6:44563352-44563374 GGCTGGGCCTGACCTGGTGCAGG + Intergenic
1011515757 6:88150754-88150776 AGCTGTTCCTTACATGGTCCTGG - Intronic
1018778887 6:167044664-167044686 AGCTCGACCTTACCTTGTTCGGG - Exonic
1019562660 7:1666161-1666183 GGCCCCTTCTTACCTGGGCCGGG - Intergenic
1024047139 7:45592576-45592598 AGCTCGTCCTCACCCTGTCCGGG - Intronic
1029326933 7:99817892-99817914 GCCTCATCCTTACCAGCTCCTGG + Intergenic
1032017359 7:128388650-128388672 GGCTGCTCTTTACCTGTTCCAGG + Intergenic
1033550074 7:142438887-142438909 GGCTCCCCCTGACATGGTCCAGG - Intergenic
1035311818 7:157974540-157974562 GGCTCGTCCATGCCTTGTCGTGG + Intronic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1045326059 8:101118705-101118727 GCCTCGTCCTGTCCTTGTCCTGG - Intergenic
1049086146 8:140480094-140480116 GGCTGGTCCTCATCCGGTCCTGG - Intergenic
1053454984 9:38226972-38226994 GGCTCGTTCATACCTGCTGCCGG + Intergenic
1055539434 9:77287281-77287303 GCCTCGACCTTCCCTGGCCCAGG + Intronic
1055937259 9:81614639-81614661 AGTTAATCCTTACCTGGTCCCGG - Intronic
1057795838 9:98157447-98157469 GGGGTGTCCTTACCTGGTGCAGG + Exonic
1060586104 9:124786986-124787008 AGGTCATCCTCACCTGGTCCAGG - Exonic
1061896553 9:133651549-133651571 GGCTGCTCCCTACCGGGTCCTGG + Intronic
1061903125 9:133683192-133683214 GGCTGGCCCTTTCCTGGCCCTGG - Intronic
1062696181 9:137877583-137877605 GGCTCGTCCGCTCCTGGGCCCGG + Intergenic
1203564346 Un_KI270744v1:79387-79409 GGCTGGTCCTACCCAGGTCCTGG - Intergenic
1185643652 X:1601581-1601603 TGCCCGTCATTACCTGTTCCAGG - Exonic
1193807615 X:86013322-86013344 GCCTGGACCTCACCTGGTCCTGG - Intronic
1198750347 X:139932297-139932319 GGATCGCCCTTATCTGGCCCCGG + Intronic
1199280786 X:145996951-145996973 AGCTTGTTCTCACCTGGTCCTGG - Intergenic