ID: 1113861528

View in Genome Browser
Species Human (GRCh38)
Location 13:113490581-113490603
Sequence CGCAGGCGGCGCGCTGGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113861528_1113861540 16 Left 1113861528 13:113490581-113490603 CCACATCCAGCGCGCCGCCTGCG 0: 1
1: 0
2: 1
3: 11
4: 100
Right 1113861540 13:113490620-113490642 ACCCCGACCCCGACCCCGACGGG 0: 1
1: 2
2: 8
3: 35
4: 259
1113861528_1113861544 22 Left 1113861528 13:113490581-113490603 CCACATCCAGCGCGCCGCCTGCG 0: 1
1: 0
2: 1
3: 11
4: 100
Right 1113861544 13:113490626-113490648 ACCCCGACCCCGACGGGCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 75
1113861528_1113861539 15 Left 1113861528 13:113490581-113490603 CCACATCCAGCGCGCCGCCTGCG 0: 1
1: 0
2: 1
3: 11
4: 100
Right 1113861539 13:113490619-113490641 GACCCCGACCCCGACCCCGACGG 0: 1
1: 1
2: 4
3: 21
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113861528 Original CRISPR CGCAGGCGGCGCGCTGGATG TGG (reversed) Intronic
904799744 1:33083901-33083923 CACAGGGTGCGAGCTGGATGGGG + Intronic
905687998 1:39922498-39922520 CCCAGGCTGCGCGCAGGAAGCGG + Intergenic
910760114 1:90724927-90724949 GGCAAGCGGCGGGCTGGATTAGG + Intergenic
1064086428 10:12349396-12349418 CGAAGGCGGCGCGCTGGAGGCGG + Intergenic
1065140537 10:22714668-22714690 CGCGGGCGGGGCACTGGGTGCGG + Intergenic
1076909531 10:133379994-133380016 CGCAGGTGGCGTGGTGGAGGTGG + Exonic
1077214679 11:1390416-1390438 CGCTGGCAGCGCGCTGGGTGGGG + Intronic
1083648531 11:64186616-64186638 CGCAGGGGGCGGGGTGGAGGTGG + Intronic
1084671937 11:70612076-70612098 CCCAGGAGGGGAGCTGGATGGGG + Intronic
1091857524 12:3751667-3751689 CGCAGAGGGCGTCCTGGATGTGG - Intronic
1095160090 12:38905650-38905672 CGGAGGCAGCGCGCGGGATGGGG + Intronic
1105040253 12:132955963-132955985 CGGCGGCGGGGCGCTGAATGTGG - Intronic
1106226849 13:27792648-27792670 CGCAGAGGGCGGGCTGGCTGCGG + Exonic
1112508145 13:99987818-99987840 CGCGGGTGGCGCGATGGCTGCGG + Intergenic
1113834435 13:113319496-113319518 CGCAGGGGGCGCTGTGGTTGGGG - Exonic
1113861528 13:113490581-113490603 CGCAGGCGGCGCGCTGGATGTGG - Intronic
1113914723 13:113863549-113863571 AGCAGCCGGCGGGCGGGATGCGG - Intronic
1115809420 14:37090345-37090367 TGCAAGCAGCGCCCTGGATGTGG + Intronic
1117097634 14:52314397-52314419 CGCCGTCGGCGCGCTGGGTGCGG + Exonic
1117478397 14:56119060-56119082 CGGACGCGGCGCGCGGGAAGTGG - Intronic
1119325949 14:73759680-73759702 CCCAGGCGGCGCGCGAGCTGTGG - Intronic
1119438025 14:74610895-74610917 CGCACGCTGAGGGCTGGATGCGG - Intronic
1120503745 14:85328069-85328091 CGCATGCGGCGTTCTGGAAGGGG + Intergenic
1121831899 14:97059973-97059995 AGCAGGTGGCAGGCTGGATGAGG + Intergenic
1124485554 15:30111921-30111943 CGCAGCCCGTGGGCTGGATGCGG - Intergenic
1124518022 15:30385346-30385368 CGCAGCCCGTGGGCTGGATGCGG + Intronic
1124540631 15:30580907-30580929 CGCAGCCCGTGGGCTGGATGCGG - Intergenic
1124758024 15:32426675-32426697 CGCAGCCCGTGGGCTGGATGCGG + Intergenic
1128067739 15:64775235-64775257 CTCCGGCGGCGCCCTGGAGGAGG - Exonic
1129348243 15:74938020-74938042 CGATGGCGGCGCGCGGGCTGAGG + Exonic
1130270644 15:82445266-82445288 CGCAGGGGGCGCGCGGGTTGAGG + Intergenic
1130462988 15:84172589-84172611 CGCAGGGGGCGCGCGGGTTGAGG + Intronic
1130489686 15:84422199-84422221 CGCAGGGGGCGCGCGGGTTGAGG - Intergenic
1130501277 15:84500961-84500983 CGCAGGGGGCGCGCGGGTTGAGG - Intergenic
1131302881 15:91215034-91215056 TGCAGGCAGCGCTCCGGATGTGG - Intronic
1137404632 16:48179715-48179737 CACAGGAGGGGCCCTGGATGAGG + Intronic
1138101182 16:54253433-54253455 CGTAAGAGGTGCGCTGGATGGGG - Intronic
1139469423 16:67170401-67170423 CGGAGGCCGCGCGCTGGCTGGGG - Intronic
1140223332 16:73058987-73059009 CGGAGGGGACGCGCTGGAAGTGG + Intronic
1140457810 16:75114956-75114978 CGCAGACGCCGCCCTGGTTGGGG + Exonic
1142293103 16:89201669-89201691 CGCAGGCTGCGCTCGGGACGGGG + Intergenic
1142957847 17:3533299-3533321 CCCAGGCGGCGTGTTGGAGGAGG - Intronic
1144500941 17:15786454-15786476 CGCAGGCGCCGGGCCGGGTGGGG - Intergenic
1144634088 17:16893016-16893038 CCCAGGAGGGGCGCTGGGTGGGG + Intergenic
1146219833 17:31008718-31008740 CGGAGGCGGCGGGCAGGACGGGG - Intergenic
1147996155 17:44361546-44361568 GGCAGGCGTGGCGCTGGCTGCGG - Intronic
1148688307 17:49512943-49512965 CGAGGTCGGCTCGCTGGATGCGG - Exonic
1151400589 17:73853433-73853455 CACAGGGGGCAGGCTGGATGAGG - Intergenic
1153219163 18:2847172-2847194 CGCCCGCTGCGCGCGGGATGTGG + Exonic
1157863947 18:51165160-51165182 GGCAGGCGGAGCTCTGGAGGTGG - Intergenic
1160719067 19:589753-589775 CGGAGGCGGCGCGCGGGGAGGGG + Intergenic
1161329564 19:3679794-3679816 CCCAAGGGGCGCCCTGGATGTGG + Intronic
1161707529 19:5829167-5829189 CGCCGGCTTCGGGCTGGATGGGG - Intergenic
1161710415 19:5844438-5844460 CGCAGGGGCAGCGCTGGATCTGG - Exonic
1161714419 19:5867285-5867307 CGCAGGGGCAGCGCTGGATCTGG - Exonic
1162664133 19:12195341-12195363 CGCAGGCGTCGCGCAGGAACGGG - Intergenic
1163490827 19:17616375-17616397 CGCGGGCGGCGGGCGGGAGGCGG + Intronic
1163666451 19:18606142-18606164 CGCGGTTGGCGCGCTGGGTGCGG - Intronic
1164992126 19:32692146-32692168 CTCCGGCGGAGTGCTGGATGCGG + Exonic
1165854226 19:38870243-38870265 CGCAGGCCCCGCGCTGGAGACGG - Exonic
1166785184 19:45363292-45363314 CGCAGGCTGGGAGCTGGAGGAGG - Intronic
1167648253 19:50717202-50717224 CGCAGGGGGCGGGCTGCAAGCGG - Intronic
1168641383 19:58034049-58034071 CGCCCGCGGCGCGCAGGGTGCGG + Exonic
927542580 2:23926560-23926582 CGCCGGCGTCACTCTGGATGAGG - Exonic
927542686 2:23926951-23926973 AGCAGGCGGCGTGCGGGAAGCGG + Exonic
932212130 2:69940868-69940890 CGCACGGGGCGCGGAGGATGGGG - Exonic
941580617 2:167292816-167292838 CGCGGGAGGGGCGCAGGATGGGG - Intergenic
941929924 2:170929274-170929296 AGCAGGCGGTGCGCTGGGGGCGG + Exonic
944547451 2:200812057-200812079 GGGAGGCGGCGGGCTGGATGCGG + Intronic
946386615 2:219387813-219387835 GGCAGGCGGCGCGGTGGGGGCGG - Exonic
1174341083 20:49895904-49895926 CACAGGAGGCGGGCTGGATTTGG - Intergenic
1179659615 21:42865912-42865934 CCCAGGCGGCTCTCTGGAGGGGG - Intronic
1180014925 21:45075340-45075362 GGCAGGCTGCGCCCGGGATGAGG + Intronic
1182511303 22:30822347-30822369 AGCAGGCGACGCGCGGGACGAGG + Intronic
1182532131 22:30968873-30968895 CGCGGGCGGCGCGCGGGCGGCGG - Intergenic
1185366058 22:50437317-50437339 CTCAGGCTGCGCGCTCGCTGCGG - Intronic
950460521 3:13119628-13119650 AGCAGACGGTGGGCTGGATGTGG + Intergenic
954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG + Intergenic
954798161 3:53172017-53172039 CCCAGGAGGAGCGCTGGCTGGGG + Intronic
954802629 3:53195997-53196019 CGCAGGCGGGGCGCAGGTTGTGG - Intergenic
957639824 3:82837855-82837877 TGCAGCCGGCGGGCTGCATGTGG - Intergenic
958112318 3:89164349-89164371 CGCATGCGGCCCACTGGCTGTGG + Intronic
961654277 3:128432913-128432935 CGCAGGTGGCGCGGGGGAGGGGG - Intergenic
967316202 3:188154069-188154091 CGCGGGCGGCGCGCTCGAGGAGG + Intronic
968460763 4:723686-723708 CGGAGGCTGCTGGCTGGATGGGG + Intronic
968573693 4:1355253-1355275 GGCAGGCGGCGAGCGGGAAGGGG + Intronic
968879578 4:3292367-3292389 CGAAGGCGGCGCGGTGACTGCGG - Intergenic
976184168 4:82429198-82429220 CGCGTGCGGCGCGCTGGGGGAGG + Intronic
992611267 5:78510369-78510391 CGCAGGCGGTGCTCTGGGTCCGG - Exonic
1005288964 6:24359902-24359924 CGCAAGCGGGGCCCTGGTTGGGG + Intergenic
1006797802 6:36742292-36742314 CGCAGGGGGCGTGCGGGCTGGGG + Exonic
1007176625 6:39901866-39901888 TGCAGGCAGCTCGCTGGAGGAGG + Exonic
1007451307 6:41941765-41941787 CGCGGGCGGCGGGCGGGCTGGGG - Exonic
1015149039 6:130019120-130019142 CGCAGGCGGCGGGATGCGTGTGG + Intronic
1017540392 6:155396497-155396519 CTCAGGGGGCGAGCTGGATTTGG - Intronic
1019111980 6:169724132-169724154 CGCGGGCGGCGCGCTGGCGACGG - Intronic
1019545154 7:1570554-1570576 CTCAGGCGGCGGGCGGGCTGGGG + Intronic
1019562749 7:1666392-1666414 CGCCCGCGGGGCTCTGGATGCGG + Intergenic
1020029346 7:4921765-4921787 CCCAGGCTGGGCGCCGGATGGGG + Intronic
1024579795 7:50792849-50792871 CGCCGGCGGCTCGCGGGCTGTGG - Intronic
1029195367 7:98801984-98802006 TGCAGGAGGAGCCCTGGATGGGG - Intergenic
1029207972 7:98880223-98880245 CGCAGGCAGCAGGCTGGATTGGG - Intronic
1034182138 7:149147379-149147401 GGCAGGGGGCGCGCTGGCCGCGG + Intronic
1037825248 8:22156652-22156674 CGCAGGCGGGCCCCTGGCTGCGG - Exonic
1045231408 8:100310169-100310191 CGCGGGCGGCGCGCTGGGGCGGG - Intronic
1048990258 8:139756570-139756592 CGCAGGAGGAGCCCGGGATGGGG + Intronic
1049619451 8:143591471-143591493 CGCAGGCTGAGCGCGGGCTGGGG - Intronic
1049709521 8:144057360-144057382 CTCAGGCTGGGGGCTGGATGGGG - Intronic
1058908116 9:109497979-109498001 CGCGGGCGGGGCGCCGGGTGGGG - Intronic
1060979962 9:127786124-127786146 CGGCGGCGGCGCGTTGGAGGCGG + Exonic
1061624250 9:131831823-131831845 AGCAGGCAGCGGGCTGGATCAGG - Intergenic
1202372201 Y:24206022-24206044 CGCAGGGGGCGCGCGGTTTGAGG - Intergenic
1202498584 Y:25464094-25464116 CGCAGGGGGCGCGCGGTTTGAGG + Intergenic