ID: 1113863573

View in Genome Browser
Species Human (GRCh38)
Location 13:113507002-113507024
Sequence GACAGAGTCAGATGCGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113863573 Original CRISPR GACAGAGTCAGATGCGTGGA AGG Intronic
900573194 1:3370036-3370058 GACTGAGTCAGCTGCAGGGAAGG + Intronic
901225101 1:7608794-7608816 GACAGAGCCAGAAGCGTGGGAGG + Intronic
904329496 1:29748884-29748906 CACAGAGTCATATCCGTGCAAGG - Intergenic
904392981 1:30197919-30197941 GCCAGAGACAGATGGGAGGAGGG + Intergenic
904538859 1:31219344-31219366 GACAGCGCCAGCTGCTTGGAAGG - Intronic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
906946627 1:50300280-50300302 GACAGAGCCACATGAGAGGAAGG + Intergenic
911386736 1:97185192-97185214 CACAGAGTAAGATACATGGAAGG + Intronic
912002792 1:104856150-104856172 CACACCGGCAGATGCGTGGAAGG - Intergenic
912756475 1:112328985-112329007 GAAAGAGTCAGCTGCCAGGAGGG + Intergenic
912805900 1:112756943-112756965 GACAGAGTCACATGCGAAGTGGG - Intergenic
912921170 1:113868726-113868748 GACAGGGGCAGATGGGTGTAGGG + Intronic
915935808 1:160089720-160089742 GAGAGAGGCAGAGGGGTGGAAGG + Exonic
921477812 1:215631738-215631760 GACTGAGTCAGGTGTGAGGATGG - Intronic
921685721 1:218086868-218086890 GACAGAATTAGATGAATGGAAGG + Intergenic
924514051 1:244751602-244751624 GACAGAGGCAGAGGTGAGGAAGG - Intergenic
1064966817 10:21022447-21022469 CACGGAGTCAGATTCGTGGTAGG + Intronic
1065134356 10:22653471-22653493 GAAAGATTAAGATGAGTGGAAGG - Intronic
1065243903 10:23738061-23738083 GGCAGAGTATTATGCGTGGAGGG - Intronic
1068847566 10:61696016-61696038 GACAGATTAAGATGGATGGATGG + Intronic
1071554792 10:86593702-86593724 GACAGAGTGAGATGAAGGGAAGG + Intergenic
1077066996 11:645833-645855 GACAGAGGCAGCTCCGTGCACGG + Intronic
1077844599 11:6011853-6011875 GACAGATTCAGGTGCCAGGATGG + Intergenic
1078197408 11:9147639-9147661 GACAGATTCAGAGGCGAGAAAGG + Intronic
1079356738 11:19736065-19736087 GGCAGAGTGAGGTCCGTGGAGGG + Intronic
1079945163 11:26732831-26732853 CACAGACTCAGAGGCGTAGAAGG + Intergenic
1084182654 11:67454495-67454517 GGCAGAGGCCGATGGGTGGAAGG + Intronic
1084465509 11:69320823-69320845 GAGAGAGTGAGAGGTGTGGACGG + Intronic
1084972539 11:72779777-72779799 GACAGAGTCAGAGGGGAGAAGGG + Intronic
1089404559 11:118186826-118186848 TACAGAGTTAGGTGGGTGGATGG - Intergenic
1094366963 12:29694177-29694199 TAGAGAGTCAGATACGGGGATGG - Intronic
1096696930 12:53355276-53355298 GACAGAGCAAGATGGATGGAAGG + Intergenic
1101244321 12:102871000-102871022 GACAGACTCAGATGTTTGAATGG - Intronic
1101575697 12:105994341-105994363 GAAAGAGTCGGAGGTGTGGAAGG + Intergenic
1101896678 12:108762232-108762254 GACAGAGTGAGATGGAAGGAGGG + Intergenic
1102940480 12:116937066-116937088 GACAGAGTCAGGATTGTGGATGG + Intronic
1106525010 13:30532852-30532874 CACAGATTCACATGCATGGATGG - Intronic
1108032998 13:46256417-46256439 GACAGAGCCAGAAGCCAGGAGGG + Intronic
1110167580 13:72461663-72461685 GACAGAGACAGTTGCCAGGAAGG + Intergenic
1112154303 13:96800646-96800668 GACAGATGCAGATACGTGGGTGG - Intronic
1113004011 13:105678564-105678586 GGAAGAGTCAGAAGCATGGAAGG + Intergenic
1113853686 13:113432508-113432530 GCCAGAGTCAGATGCTGAGAAGG - Intronic
1113863573 13:113507002-113507024 GACAGAGTCAGATGCGTGGAAGG + Intronic
1114523602 14:23353730-23353752 GACAGTGTGAGATGAGAGGAGGG - Intergenic
1114666601 14:24381046-24381068 GACAGAGCCAGGTGAGGGGAAGG - Intergenic
1117435665 14:55713201-55713223 CACAGAGCCAGATTCCTGGAGGG - Intergenic
1119378890 14:74216214-74216236 AACAGAATCAGATGGCTGGAGGG - Intergenic
1122639145 14:103147094-103147116 GAAAGAGGCAAATGCTTGGAAGG - Intergenic
1124420426 15:29516255-29516277 CACACAGTCAGATACATGGATGG + Intronic
1124686293 15:31785612-31785634 GCCAGAGTCAGAATCATGGAAGG - Intronic
1126097012 15:45097130-45097152 GACAGAGTCAGAGGCAGTGATGG + Intronic
1126185487 15:45827419-45827441 TACAGAGTGAGATGGGTTGAGGG + Intergenic
1126340653 15:47637389-47637411 GACATAGTCAGATTAGTGGATGG - Intronic
1130098792 15:80876256-80876278 GACAGGGTCAGGTGCTTGGCTGG - Intronic
1130229026 15:82082418-82082440 CACAGAGTCTGATCCCTGGAGGG - Intergenic
1132832122 16:1933531-1933553 GACAGAGTCAGCTCCGTGAGGGG + Intergenic
1132942030 16:2513259-2513281 GGCAGAGACAGGTGCGGGGAGGG + Intronic
1133516953 16:6518725-6518747 GACAGAGATAGATGGATGGATGG - Intronic
1134104498 16:11476182-11476204 AACAGGGGCAGATGCGAGGAGGG + Intronic
1137558135 16:49485745-49485767 GTCAGAGACAGGTGGGTGGAAGG + Intergenic
1140692614 16:77498825-77498847 GAGAGAGTCAGAGGCGGGGGAGG + Intergenic
1141599402 16:85116085-85116107 GACAGTGTCAGATGCCAGCACGG - Intergenic
1141620034 16:85232410-85232432 GACATCCTCAGATGGGTGGATGG + Intergenic
1143105500 17:4528416-4528438 TACAGGATAAGATGCGTGGAGGG + Intronic
1143204450 17:5132436-5132458 GTAAGAGCCTGATGCGTGGAGGG + Intronic
1146155455 17:30520400-30520422 GTCAGTGGCAGATGCTTGGAAGG + Intronic
1146844211 17:36173385-36173407 GTAAGAGCCTGATGCGTGGAGGG - Intronic
1146856516 17:36261320-36261342 GTAAGAGCCTGATGCGTGGAGGG - Intronic
1146864101 17:36327055-36327077 GTAAGAGCCTGATGCGTGGAGGG + Intronic
1146872426 17:36385231-36385253 GTAAGAGCCTGATGCGTGGAGGG - Intronic
1146879784 17:36436316-36436338 GTAAGAGCCTGATGCGTGGAGGG - Intronic
1147066961 17:37927643-37927665 GTAAGAGCCTGATGCGTGGAGGG + Intronic
1147075310 17:37985855-37985877 GTAAGAGCCTGATGCGTGGAGGG - Intronic
1147078493 17:38007204-38007226 GTAAGAGCCTGATGCGTGGAGGG + Intronic
1147086835 17:38065401-38065423 GTAAGAGCCTGATGCGTGGAGGG - Intronic
1147094431 17:38131139-38131161 GTAAGAGCCTGATGCGTGGAGGG + Intergenic
1147102780 17:38189364-38189386 GTAAGAGCCTGATGCGTGGAGGG - Intergenic
1149389411 17:56174190-56174212 CACAGAGCCAGATGCCTGCAGGG + Intronic
1149571687 17:57676730-57676752 GCCAGATTCAGAGGCGTGGGTGG - Intronic
1153295481 18:3541995-3542017 GACTGAGTCAGAGGTGTTGAAGG - Intronic
1154306655 18:13235480-13235502 AGCACAGTCAGATGCCTGGAGGG - Intronic
1154353269 18:13604963-13604985 GAGAGAGCCAGATGCCAGGAAGG - Intronic
1154471911 18:14711951-14711973 GACAGAGGCAGATGAGGGGCAGG - Intergenic
1155417608 18:25616788-25616810 GAGAGAGTCAGCTGAGTGGAAGG + Intergenic
1156786460 18:40921298-40921320 GACAGAGCCAGCTGAGTGCAGGG - Intergenic
1157575952 18:48743241-48743263 CACAGAGTCAGATGGGTGTTGGG - Intronic
1160141335 18:76326231-76326253 GACAGAGTAAGATGTGTTAATGG + Intergenic
1160225281 18:77007071-77007093 GACAGAAGCAGCTGGGTGGAAGG - Intronic
1161005937 19:1936502-1936524 GACAGAGAGAGATGTGGGGAGGG + Intergenic
1163148790 19:15399268-15399290 GGCAGAGGCAGAGGGGTGGAGGG + Intronic
1163806643 19:19403348-19403370 GACAGGGTCAGATGGGTAGATGG - Intronic
1164212936 19:23116424-23116446 GACAGAGTGAGATGAAAGGAAGG - Intronic
1166297914 19:41897640-41897662 GAGAGAGTCAGAGGAGTGGTGGG - Intronic
1166878385 19:45912143-45912165 GACAAAGCCAGATGAGAGGATGG + Intergenic
1167449771 19:49560297-49560319 GTCACAGTCAGAAGGGTGGAGGG - Intronic
1167856797 19:52248518-52248540 GACAGAGACAGAGGCCAGGAGGG + Intergenic
1168024140 19:53631525-53631547 GACCGAGTCAGAAACGTTGAGGG + Intergenic
927679374 2:25129945-25129967 GACAGAGGCACATGGGTAGAGGG - Intronic
927721931 2:25388636-25388658 GACAGAGTGAGCTGCGTGACTGG + Intronic
928918012 2:36494578-36494600 GACAGTGTAAGGTGCTTGGAGGG + Intronic
928938292 2:36702954-36702976 GTCTGAGTCAGGTGCATGGAGGG - Intronic
933331321 2:80896355-80896377 GACACAGTCAGATACCTGGGAGG - Intergenic
935542308 2:104362999-104363021 GACACACTCAGATGAGTGCAAGG - Intergenic
935782583 2:106521064-106521086 GAGAGAGACAGATGCGAGAATGG + Intergenic
937908322 2:127063499-127063521 GTCAGAGTCAGAGTCGTGGGAGG - Intronic
938816546 2:134910362-134910384 GAAAGAGAAAGATGCTTGGATGG - Intergenic
940267881 2:151859242-151859264 GTCAGAGTCAGTGGGGTGGATGG - Intronic
941517389 2:166495914-166495936 GTCAGTGTCAGAAGTGTGGATGG + Intergenic
944081722 2:195795867-195795889 AACAAAGCCAGATGGGTGGATGG + Intronic
944955880 2:204808482-204808504 GACAGAGGCAGGTGGGAGGAGGG - Intronic
947295396 2:228625277-228625299 GTCAGCGTCAGGTGCATGGAGGG - Intergenic
1169052650 20:2593952-2593974 GACAGTGTGTGATGCGTGCAGGG - Intronic
1170053924 20:12178084-12178106 GCCGGAGTCAGATGGGTGGCAGG + Intergenic
1173300370 20:41797058-41797080 GAAATAGTCAGATGTGTGGCTGG - Intergenic
1173480959 20:43399040-43399062 GACAGAGTGAGAGGCATGGAAGG - Intergenic
1173743372 20:45418447-45418469 GACCTAGTAAGATGCTTGGATGG + Intronic
1175161321 20:57009915-57009937 GCCACAGTCAGAAGCCTGGACGG - Intergenic
1175552983 20:59828935-59828957 GAGAGAGGCAGATGGATGGATGG + Intronic
1175680592 20:60985554-60985576 GCCAGAGTCAGATGGATGGATGG - Intergenic
1176802582 21:13445938-13445960 GACAGAGGCAGATGAGGGGCAGG + Intergenic
1178633315 21:34281156-34281178 GACAGAGGAGGCTGCGTGGAAGG - Intergenic
1180952766 22:19728199-19728221 GACAGAGTCACATGCGGTGGGGG + Intergenic
1182062345 22:27407264-27407286 GACAGGGAGAGATGCGAGGAGGG + Intergenic
1183950518 22:41350063-41350085 GACAGAGACAGACTCGGGGATGG + Intronic
1184557313 22:45240451-45240473 GACAGACCCAGATGCAGGGACGG + Intronic
1185371084 22:50461301-50461323 GGCAGAGTCAGAAGCAAGGAAGG + Intronic
951397234 3:22184162-22184184 AACAGAGTCAGAGGGGTGAAGGG - Intronic
952270083 3:31822117-31822139 TACAGAGTCTGATATGTGGAGGG - Intronic
954100827 3:48371427-48371449 GAGAGAGCCAGAGCCGTGGAAGG - Intergenic
956221224 3:66905939-66905961 GAAAAAATCAGAAGCGTGGAAGG - Intergenic
960036052 3:113104363-113104385 GACAGAGTGAGAAGTGAGGATGG - Intergenic
961826906 3:129603916-129603938 GCCAGACTCAGATGGGTGGAGGG + Intronic
968597920 4:1494909-1494931 CACACAGTCAGAGGCCTGGAGGG - Intergenic
970988107 4:22181496-22181518 GATAGAGACAGATGGGTGGATGG + Intergenic
970988112 4:22181593-22181615 GATAGAGACAGATGGGTGGATGG + Intergenic
971446852 4:26759644-26759666 GACAGAAGCAGATGAGTGGTTGG - Intergenic
974310862 4:60208769-60208791 GAGAGAGTCAGAAGGGTGGGGGG + Intergenic
980586515 4:134823623-134823645 TAGAGAGCCACATGCGTGGAAGG - Intergenic
981100909 4:140828346-140828368 GACAGAGACAGAGGCATAGAGGG - Intergenic
984610838 4:181834995-181835017 GACAGACACAGAAGTGTGGAGGG + Intergenic
985681256 5:1257053-1257075 CACAGAGTCAGGCACGTGGAAGG - Intronic
987038278 5:14038948-14038970 GACAGAGACAGATGGGAGAAGGG - Intergenic
988615872 5:32774377-32774399 GATAGAGGCAGATGTGGGGAAGG + Intronic
988846970 5:35136994-35137016 AACAGAGGCAGATGAGTAGAAGG + Intronic
991933378 5:71778263-71778285 GATAGAGGCAGATGCAGGGATGG - Intergenic
993843465 5:92909851-92909873 GACAGAGACAGATGGCTGGGAGG - Intergenic
994176629 5:96718771-96718793 GACAGATTCAGGTGTGTGAAGGG + Intronic
998557850 5:143143144-143143166 GACAGAGTCCCATGCATGGGGGG + Intronic
999228779 5:150049176-150049198 GACAGAGTGAGCTGAGAGGAGGG + Intronic
999816764 5:155184724-155184746 GAAAGAGTCAGAAGCCTGAAGGG - Intergenic
1001149359 5:169213890-169213912 GACAGACTCAGAAGCTTGGAAGG + Intronic
1001710084 5:173771556-173771578 GACAGAGTCACATGCATCGCTGG + Intergenic
1006003209 6:30982865-30982887 GACACAGTCTGATGGGAGGAGGG - Intergenic
1007740892 6:44008891-44008913 GACAGACCCTGATGGGTGGAGGG + Intergenic
1008490825 6:52085446-52085468 GGCAGAGGCTGATGTGTGGAAGG - Intronic
1011153987 6:84308591-84308613 GACAGAGGCAGATATATGGATGG - Intergenic
1011559190 6:88598043-88598065 GACAGAGTAAGCTGCTTGGCAGG + Intergenic
1015166584 6:130206222-130206244 GACAGAGTCAGTTGGCTGGGAGG + Intronic
1015764016 6:136696523-136696545 GACAGACTCACATCCATGGAGGG - Intronic
1018851916 6:167646575-167646597 GACGGAGACAGATGCATGGTTGG - Intergenic
1019162831 6:170080582-170080604 GACAGAGTCAGGAGCGGGGAAGG + Intergenic
1019602578 7:1892731-1892753 GTCAGGGCCAGAGGCGTGGACGG - Intronic
1021936410 7:25636430-25636452 GAGAGAGTCACATCCATGGAGGG + Intergenic
1023029088 7:36077573-36077595 GACATGGTCAGATGTGTAGAGGG - Intergenic
1031995195 7:128226189-128226211 AACATAGACAGATGGGTGGATGG - Intergenic
1032224347 7:130018961-130018983 GACAGATACAGATGCCTGAAGGG - Intronic
1032656788 7:133939055-133939077 GACAGATTTAGATGTGTGAATGG + Intronic
1035727058 8:1831229-1831251 GACAGTGTGACATCCGTGGAGGG + Intronic
1035727103 8:1831467-1831489 GACAGTGTGACATCCGTGGAGGG + Intronic
1035727112 8:1831511-1831533 GACAGTGTGACATCCGTGGAGGG + Intronic
1035727121 8:1831555-1831577 GACAGTGTGACATCCGTGGAGGG + Intronic
1038962939 8:32541715-32541737 GAGAGATTCAGATGCTTTGATGG - Intronic
1039248121 8:35632003-35632025 GACAATGTCAGATGCATGCACGG - Intronic
1040595898 8:48837322-48837344 GAGAAAGACAGATGTGTGGAGGG + Intergenic
1045056546 8:98373062-98373084 GAGAGAGTCAGATGAGGGGAAGG + Intergenic
1047424904 8:124736333-124736355 CAGAGAGCCAGCTGCGTGGAGGG + Intergenic
1048174572 8:132140255-132140277 GACACATCCAGAGGCGTGGAAGG - Intronic
1048252730 8:132880085-132880107 GACAGAGTCACATGCCTTGCAGG + Intronic
1048429689 8:134358568-134358590 GAGGGAGTCAGATGCTTGAAGGG - Intergenic
1050122804 9:2325226-2325248 GAAGGAGTCAGATGCATGAAGGG - Intergenic
1050764598 9:9116453-9116475 GAGAGAGTCAGAAGTGGGGAGGG + Intronic
1050827301 9:9964109-9964131 GAGAGAGACAGATGCCTGTATGG + Intronic
1054337097 9:63817138-63817160 GACAGAGTGAGATGGAAGGATGG - Intergenic
1059398823 9:114055652-114055674 GACACAGTCAGATGTGTCTATGG - Exonic
1062005483 9:134236594-134236616 AACAAAGACAGATGCGTGGCAGG - Intergenic
1062035089 9:134379430-134379452 CACAGACACAGATGCCTGGATGG - Intronic
1062420354 9:136477876-136477898 GACAGAGTGAGAACCCTGGATGG + Intronic
1203377034 Un_KI270442v1:384559-384581 GACAGAGTGAGATGGAAGGATGG - Intergenic
1185709586 X:2292472-2292494 CACAGACTCAGCAGCGTGGAAGG - Intronic
1186345800 X:8691490-8691512 GACAGATTAAGATGGATGGATGG + Intronic
1188105888 X:26146175-26146197 GACAGACTCTGATGGGAGGAGGG - Intergenic
1192176280 X:68887597-68887619 GGCAGGGTCAGATGTGAGGATGG - Intergenic
1192499323 X:71639111-71639133 GACAGAGTGAGTTTGGTGGAAGG - Intergenic
1193973964 X:88094252-88094274 CACAGAGCCAGCTGTGTGGAAGG - Intergenic
1195139274 X:101942711-101942733 GACAGAGCCTGATTCATGGAGGG + Intergenic