ID: 1113864599

View in Genome Browser
Species Human (GRCh38)
Location 13:113512719-113512741
Sequence GAAGGGGGCCGGAGTGTAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 4, 2: 2, 3: 15, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113864593_1113864599 -6 Left 1113864593 13:113512702-113512724 CCCAGGTGCTGGAACTGGAAGGG 0: 2
1: 3
2: 1
3: 19
4: 431
Right 1113864599 13:113512719-113512741 GAAGGGGGCCGGAGTGTAGACGG 0: 1
1: 4
2: 2
3: 15
4: 204
1113864595_1113864599 -7 Left 1113864595 13:113512703-113512725 CCAGGTGCTGGAACTGGAAGGGG 0: 2
1: 3
2: 1
3: 23
4: 287
Right 1113864599 13:113512719-113512741 GAAGGGGGCCGGAGTGTAGACGG 0: 1
1: 4
2: 2
3: 15
4: 204
1113864591_1113864599 -5 Left 1113864591 13:113512701-113512723 CCCCAGGTGCTGGAACTGGAAGG 0: 2
1: 3
2: 0
3: 20
4: 281
Right 1113864599 13:113512719-113512741 GAAGGGGGCCGGAGTGTAGACGG 0: 1
1: 4
2: 2
3: 15
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113864599 Original CRISPR GAAGGGGGCCGGAGTGTAGA CGG Intronic
900087390 1:904968-904990 GGAGGGGGCCGGAGGGTCGGGGG + Intergenic
900176996 1:1295369-1295391 GAAGGGTGCCTGAGTGTGGATGG - Intronic
900314031 1:2048283-2048305 GAAGGGGGGCAGAGAGTAGAGGG - Intergenic
900329196 1:2125701-2125723 GAAGGAGGCTGGAGTGTGGGCGG + Intronic
900998004 1:6133293-6133315 GGAGTGGGCTGGAGTGGAGATGG - Intronic
901303587 1:8217074-8217096 GGAGGGGACCGGAGAGCAGAGGG + Intergenic
902330004 1:15726643-15726665 GAAGGGGGGCTGAGTGGAGGGGG + Intronic
902375326 1:16027629-16027651 CAAGGGGCCCTGAGGGTAGAAGG + Intronic
902380289 1:16049426-16049448 GCAGGGGCCCTGAGGGTAGAAGG + Intronic
902702756 1:18183827-18183849 GAAGGGGGCAGAAATGCAGAAGG + Intronic
904434839 1:30487657-30487679 TAAGGGGGCAGGAGTGTGGATGG + Intergenic
904832917 1:33316744-33316766 GAAGGGGGCTGGAGCCCAGAAGG + Intronic
905018586 1:34793507-34793529 GAAGGGGGTGGGAGTGGAGGTGG + Intronic
905304122 1:37005868-37005890 GATGGGGGCCAGATTGTGGAAGG + Intronic
906180136 1:43810927-43810949 GGAAGGGGCCAGAGTGCAGAGGG - Intronic
908817552 1:68049976-68049998 GAAGGTGGAAGGAGTGTGGAGGG - Intronic
909692950 1:78430724-78430746 GAAGGGGGTTGGTGTGTGGATGG + Intronic
910643219 1:89486867-89486889 GAAGGGGGCAGGAGAGAGGAAGG + Intergenic
912226558 1:107740893-107740915 GTAGGGGGCCAGAGAGTAAATGG - Intronic
913374258 1:118133285-118133307 GAGGGGGCCCAGAGTGCAGATGG + Intronic
915145597 1:153794322-153794344 GGAGGTGGCCGGAGTGGAGATGG + Intergenic
918084036 1:181230132-181230154 GAAGGGGTCTGTAGTGGAGATGG + Intergenic
919735592 1:200948254-200948276 GAGGGGGGCCGGGGTGGGGAAGG + Intergenic
920115548 1:203618215-203618237 GAATTGGCCCGGAATGTAGACGG + Intergenic
922889114 1:229046873-229046895 GAGGGGGGCCTGTCTGTAGAGGG - Intergenic
924158144 1:241202751-241202773 GAAGTGGGGAGGAGTGTAGGGGG + Intronic
924853748 1:247856432-247856454 GAAGGGGCTCGGAGGGTGGAAGG + Intergenic
1062795605 10:342709-342731 GAAGGGCCCTGGAGTGTAGGAGG - Intronic
1063099178 10:2934783-2934805 TTGGGGGGCTGGAGTGTAGAGGG + Intergenic
1063179466 10:3584762-3584784 GACGGGGGCTGGAGGGGAGAAGG - Intergenic
1063665306 10:8057186-8057208 GAAGGGGAGGGGAGTGGAGAGGG - Intronic
1064099531 10:12451431-12451453 GAAGAGGGCAAGAGTGAAGATGG - Intronic
1067317212 10:45180223-45180245 GAAAGAGGCCGGAGTGTACAAGG + Intergenic
1067557835 10:47284934-47284956 GAAGGGGGCGGGAGGGAGGAAGG + Intergenic
1067557849 10:47284966-47284988 GAAGGGGGCGGGAGGGAGGAAGG + Intergenic
1067557877 10:47285030-47285052 GAAGGGGGCGGGAGGGAGGAAGG + Intergenic
1067942278 10:50667206-50667228 GAAGGGGCTCTGAGTGTGGATGG + Intergenic
1068929353 10:62573300-62573322 GACGGGGGTTGGAGTGGAGATGG - Intronic
1069853412 10:71425101-71425123 GAAGAGGGACTGAGTGCAGAAGG + Intronic
1073530061 10:104222582-104222604 CAAGGGGGCAGGAGTGAGGAGGG - Intronic
1073592147 10:104767667-104767689 GAAGGGGAAGGGAGTGGAGAAGG - Intronic
1076756860 10:132577110-132577132 GAAGGGGCCAGGAGTGGAGGGGG + Intronic
1077463012 11:2720361-2720383 GAAGGAGGCCTGACTGTAGCCGG - Intronic
1078426237 11:11253479-11253501 GAAGGGGGGCGGGGAGTGGAGGG + Intergenic
1078668030 11:13342030-13342052 GCTGGGTGCCGGAGTGCAGAGGG + Intronic
1081762685 11:45587547-45587569 GAAAGGGGGCTGAGTGAAGAAGG + Intergenic
1083174095 11:60938636-60938658 GCAGGGAGCCGAAGTGTCGAAGG - Intronic
1083289580 11:61682363-61682385 GAAGGGAGCCGGAAGGTTGAGGG + Intronic
1083573469 11:63772308-63772330 GCAGGGGTCAGGAGTGTTGAGGG + Intergenic
1083935956 11:65870256-65870278 GAAGGAGGGCGGAGGGCAGAGGG + Intronic
1085846804 11:80075439-80075461 GAAGGGTGCCCAGGTGTAGACGG - Intergenic
1089098662 11:115941175-115941197 GAATGGGGTAGGAGTGTAGTTGG - Intergenic
1090620179 11:128553677-128553699 GAGGGTGGCGGGAGTGTGGAGGG - Intronic
1093583496 12:20809401-20809423 GAAAGGAACCGGAGTGTGGAGGG - Intergenic
1097041821 12:56160496-56160518 GAAGGGGGTAGTATTGTAGAGGG + Intronic
1097680907 12:62647982-62648004 GAAGGGGGGCGGGGGGCAGACGG + Exonic
1100880424 12:99010007-99010029 GAAGGGGCCAGGAGCGTGGAGGG + Intronic
1101617401 12:106351586-106351608 GAAGGGACCCGAAGTGGAGACGG - Intergenic
1102843181 12:116148075-116148097 GAGGGGGGCGGGAGTGGAGGGGG + Intronic
1105886857 13:24649827-24649849 GAAGGGGGGAGGAGGGGAGAAGG - Intergenic
1108574426 13:51779240-51779262 AATGGGGGCCAGAGTGTTGAAGG - Intronic
1108700526 13:52940342-52940364 GAAGGGGGTGGGAGTGGAGAGGG + Intergenic
1110648588 13:77918032-77918054 GAAGGGGGCCTGGTTGGAGACGG - Intronic
1112888024 13:104197369-104197391 GAAGCGGGCTGGGGTGAAGAGGG - Intergenic
1113864436 13:113511960-113511982 GCAGAGGGCCGGAGTGTAGATGG + Intronic
1113864454 13:113512033-113512055 GGAGAGGGTTGGAGTGTAGATGG + Intronic
1113864486 13:113512181-113512203 GCAGAGGGCCGGAGTGTAGATGG + Intronic
1113864504 13:113512254-113512276 GGAGAGGGTTGGAGTGTAGATGG + Intronic
1113864530 13:113512380-113512402 CCCAGGGGCCGGAGTGTAGACGG + Intronic
1113864536 13:113512401-113512423 GGAGAGGGTTGGAGTGTAGATGG + Intronic
1113864549 13:113512473-113512495 GGAGGGGGTTGGAGCGTAGATGG + Intronic
1113864571 13:113512583-113512605 GAAGGGGGCCGGAGTGTAAACGG + Intronic
1113864586 13:113512651-113512673 GAAGGGGGCTGGAGTGTAGATGG + Intronic
1113864599 13:113512719-113512741 GAAGGGGGCCGGAGTGTAGACGG + Intronic
1113864613 13:113512787-113512809 GAAGGGGGCCAGAGTGTAGACGG + Intronic
1113864630 13:113512855-113512877 GAAGGGGGCCAGAGTGTAGATGG + Intronic
1116758551 14:48980697-48980719 GAAGGGGCAGGGAGTGGAGATGG - Intergenic
1121379967 14:93456469-93456491 GAAGAGGCCCTGAGGGTAGAAGG - Intronic
1121452236 14:94016430-94016452 GAAGGGGGTGGGAGTGGAGCTGG - Intergenic
1121960730 14:98257065-98257087 GAAGGAGGAGGGATTGTAGAAGG - Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122232475 14:100313643-100313665 GAAGGGGGCAGGAGTGGGGGCGG + Intergenic
1122859834 14:104577581-104577603 GAAGGTGGCCGGGGTGGAGTAGG - Intronic
1124887266 15:33698675-33698697 GGAGGGGGTGGGTGTGTAGAAGG + Intronic
1128705003 15:69832238-69832260 GGAGGGGGCAGGAGAGGAGAGGG + Intergenic
1129691775 15:77717871-77717893 CAAGGGGGCCCGAGTGGAGAAGG + Intronic
1131434726 15:92413786-92413808 AAAGAGGGCCGGAGTGAAAAGGG - Intronic
1132277629 15:100582792-100582814 CTAGTGGGCCGTAGTGTAGATGG - Intronic
1132277642 15:100582872-100582894 CTAGTGGGCCGTAGTGTAGATGG - Intronic
1132277658 15:100582972-100582994 CTAGTGGGCCGTAGTGTAGATGG - Intronic
1132788637 16:1672460-1672482 GAAGGGGGCGGGGGTGGAGCTGG + Intronic
1137596682 16:49728478-49728500 GAAGCGGGCAGGAGTGTCGGTGG + Intronic
1138503361 16:57462877-57462899 GCAGGGGGCGGGGGTGTAGTGGG + Intronic
1139964474 16:70737898-70737920 GAGGGAGGCCGGAGTGGAGCAGG - Intronic
1142115569 16:88354387-88354409 GCAGGCGGCGGGAGTGGAGAGGG + Intergenic
1142135674 16:88450998-88451020 GTAGAGGGACAGAGTGTAGAAGG + Intergenic
1143030284 17:3963893-3963915 GGACGGGGCCGGAGTGGAGGTGG + Intronic
1143323624 17:6084082-6084104 GGAGGCAGCCAGAGTGTAGATGG - Intronic
1143574805 17:7785985-7786007 GAACAGAGCCGGAGTGCAGAGGG + Intronic
1144201247 17:12944279-12944301 CGTGGGGGCCGGAGTGGAGATGG - Intronic
1144995445 17:19265003-19265025 GAAGGGGGCAGGTGTGGAGCTGG + Intronic
1147947289 17:44087243-44087265 GAAGGAGGCCGGTGGGGAGAAGG - Intronic
1148206700 17:45784171-45784193 GAAGGGGAGCGGAGGGGAGAGGG + Intergenic
1148603201 17:48909077-48909099 GAGGGTGGCCGGAATGGAGACGG - Intronic
1148835298 17:50462778-50462800 CAAGAGGGCTGGAGTGGAGAGGG - Intronic
1151172900 17:72263028-72263050 AAGGGGGGCAGGAGTGAAGAAGG - Intergenic
1154191378 18:12233674-12233696 GAATGGGGCCGGGGTCTCGAGGG - Intergenic
1154326093 18:13391367-13391389 GAAGGGGGTGGGAGTTTGGAAGG + Intronic
1158070235 18:53462028-53462050 GAAGAGGGATGGAGTGAAGAGGG + Intronic
1158483468 18:57843556-57843578 GAAGGGGGCTGGAGGGATGAGGG + Intergenic
1160841289 19:1148016-1148038 CAAGGGGGCCGGAGTGGGGAAGG - Intronic
1160966750 19:1750009-1750031 GAAGGCGGCTGGAGTCCAGAGGG + Intergenic
1161494823 19:4581214-4581236 GGAGGGGACCGGATTGGAGAGGG - Intergenic
1161894369 19:7069385-7069407 GAGGCGGGCCTGAGTGTTGACGG - Intergenic
1161984435 19:7645886-7645908 GAAGGGGGACGGAGAGGGGAGGG - Intronic
1162761448 19:12891071-12891093 GGAGGGGGCCGGATTCTAGGAGG + Exonic
1163505039 19:17700579-17700601 GCTGGGGGCAGGAGTGTAGGTGG + Intergenic
926010021 2:9400229-9400251 GAAGGGGGCAGGAGGGGAGGGGG - Intronic
926679777 2:15654420-15654442 GGAGAGGGCCTGAGTGGAGAAGG - Intergenic
927142632 2:20140469-20140491 GGAGGGGGCCGGAGTCCAGGGGG - Intergenic
928954079 2:36843358-36843380 GAAGGGGCAGGGAGTGTGGAAGG + Intergenic
929797489 2:45071455-45071477 GCAGGGGGACTGAGTGTTGAAGG - Intergenic
931625290 2:64251634-64251656 GCTGGGGGCCTGAGTGTGGAGGG + Intergenic
932398885 2:71466324-71466346 GAAGGAGGCAGGAGTGCAGGCGG - Intronic
932745395 2:74329826-74329848 GATGGGGGGTGAAGTGTAGATGG + Intronic
936532606 2:113287174-113287196 TAATGTGGCTGGAGTGTAGAGGG + Intergenic
941038224 2:160590583-160590605 GAAGGGGGAGGGAGAGGAGAAGG - Intergenic
942063723 2:172251013-172251035 AAAGGGGGCGTGACTGTAGAGGG + Intergenic
947542104 2:230986569-230986591 GAAGGGGGCAGGGGTGTGGGGGG - Intergenic
948237902 2:236404025-236404047 GAAGTGGGCCAGAGTGTGCAAGG - Intronic
948382361 2:237559657-237559679 GAAGCGGGGAGGAGTGAAGAAGG - Intergenic
948806005 2:240453636-240453658 GAAGGGGGCGGGCGGGGAGAGGG - Intronic
1168835105 20:872708-872730 GAAGGGGGAGGGAGAGAAGAGGG + Exonic
1170914110 20:20605966-20605988 GAAGGGGTCCAGAGTGTAAGGGG - Intronic
1172522706 20:35578790-35578812 GGAGGGGGCTGGGGTGTAAATGG - Intergenic
1173338896 20:42136602-42136624 GAAGGGGACTGGAGTTGAGAGGG + Intronic
1175915129 20:62422611-62422633 GATGGGGCCCGGAGTGGGGATGG + Intronic
1177795411 21:25773617-25773639 GGAGGGGGGCGGAGTGGTGAGGG - Intergenic
1179947003 21:44685355-44685377 GCAGCGGGCAGGAGTGTGGATGG - Intronic
1181309909 22:21939050-21939072 GCAGGGGGCCCGAGCGTTGAGGG + Intronic
1183281356 22:36934328-36934350 GAAGGAGGCCTGAGTGGAGTGGG - Intronic
1184173416 22:42772591-42772613 GAAGGGGAGAGGAGAGTAGAGGG - Intergenic
1184675816 22:46042728-46042750 GTAGAGGGCCGGTGTGCAGAAGG - Intergenic
1184807251 22:46803164-46803186 GAAGGGGGTGGGGGTGCAGAGGG - Intronic
1184850321 22:47116063-47116085 GATGGGGGCCGGCGGGGAGAGGG - Intronic
1184953434 22:47862585-47862607 GCAGGGGGCCGGTGGGTGGAAGG - Intergenic
950045769 3:9947783-9947805 GAAGGGGGCCCCAGCGTAGCGGG + Exonic
950428291 3:12936371-12936393 GGAGGGGGCCGGAGACTTGAGGG + Exonic
950656666 3:14440970-14440992 GATGGGGTCCTGAGTGTGGAAGG + Intronic
956512792 3:70012741-70012763 GAATTGGGCCAGACTGTAGAAGG + Intergenic
958949276 3:100399884-100399906 CAAGGGGTCCGGAGTGCAAAAGG + Intronic
964463307 3:156961427-156961449 GAAAGGGGCAGGAGTGTAAGGGG - Intronic
967531134 3:190549897-190549919 AAAGGGGTACGGAGTGAAGATGG + Intronic
968589363 4:1449886-1449908 AGAGGGGGCCGGAGTGGAGGCGG + Intergenic
970695907 4:18676725-18676747 GGAGGGGGCAGGAGTGGAGCTGG + Intergenic
971284166 4:25271190-25271212 GAATGGAGCCAGAGTATAGAGGG + Intronic
973052141 4:45609800-45609822 GAAGGGAGCAGAAGTGTGGAGGG - Intergenic
974168455 4:58235033-58235055 GAAGGGAGAAGGAGTGTTGATGG - Intergenic
977375582 4:96198487-96198509 GAAGGGGGTCGGAGTTTGGAGGG + Intergenic
984364730 4:178784235-178784257 GAAGGGGTCAGGAGTGCTGAGGG + Intergenic
985005423 4:185530476-185530498 GAAGGAGGGAGGAGTGAAGAGGG + Intronic
986362430 5:6993190-6993212 GAAGGGGGAAGGAGAGAAGACGG - Intergenic
987446167 5:18022085-18022107 GAGGGGGGCCGGAGTGGGTAAGG - Intergenic
989366307 5:40659557-40659579 GAAGGGGGCAAGAGTAGAGAAGG + Intergenic
991445737 5:66698370-66698392 GGAGGGGGCAGGAGTGGGGATGG - Intronic
991577172 5:68116503-68116525 GAAGGCAGCCTGTGTGTAGAAGG - Intergenic
992299538 5:75364124-75364146 GAAGTGGGCTGGAGTGGAGGTGG + Intergenic
992618445 5:78568887-78568909 AAAGGGGGCCGGAGTGTGGGTGG + Intronic
992626316 5:78638619-78638641 GCAGGCGGCCGGAGGGCAGAGGG - Intronic
992716180 5:79513769-79513791 GAAAGGGGCCGAAGGGTCGACGG + Exonic
992802093 5:80302869-80302891 GATGGGCGGCGGAGTGGAGAGGG + Intergenic
996557138 5:124790067-124790089 GAAGGGAGCCAGAGGGTGGACGG - Intergenic
996665800 5:126058795-126058817 GAAGGGGACCGGAGTGGACTGGG - Intergenic
997398130 5:133580889-133580911 GAAGGAGGCGGGTGTGGAGAGGG - Intronic
1002761505 6:205977-205999 GCAGGAGGCTGGAGTCTAGAGGG - Intergenic
1003583760 6:7367152-7367174 GAAGGGGGATGGAGGGAAGAGGG - Intronic
1004709324 6:18155249-18155271 GTACGGGGCGGGAGTGGAGACGG - Intergenic
1004866300 6:19856581-19856603 GAGGGGGGCAGGAGTGGGGAAGG + Intergenic
1005509803 6:26501927-26501949 GAAGGTGGCTGGTGAGTAGACGG + Exonic
1006173453 6:32108420-32108442 GAAGGGGCACAGAGTGAAGACGG + Intronic
1008368603 6:50709545-50709567 GAAGGGGGCCCGAGGGCAGATGG + Intergenic
1008760376 6:54846618-54846640 GGAGGGGGCGGGAGTGGAGACGG - Intergenic
1011514288 6:88135545-88135567 AAAGGGGGCAGGAGGGCAGAGGG + Intergenic
1012972701 6:105748770-105748792 GAAGGAGGCAGGATTGTAGTGGG - Intergenic
1014780184 6:125556516-125556538 CAAGGGAGCCAGACTGTAGAGGG + Intergenic
1014877977 6:126684737-126684759 GAAGGGGGAGGGAGGGAAGAGGG + Intergenic
1016909105 6:149179382-149179404 GAAGGGAGACAGAGTGGAGAAGG + Intergenic
1018829743 6:167433739-167433761 GAAGGTGGCGGTAGTGTGGATGG + Intergenic
1018829879 6:167434353-167434375 GAAGGTGGCGGTAGTGTGGATGG + Intergenic
1019422800 7:958847-958869 GATGGGGTCTGGAGTGGAGAAGG + Intronic
1022337891 7:29439549-29439571 GAAGAGGGCCTGAGTGAGGATGG - Intronic
1022942445 7:35253831-35253853 GAAGGCAGCCGGAGAGGAGAGGG + Exonic
1023920186 7:44623096-44623118 GAAAGGGGGCTGAGTGCAGAAGG + Intronic
1030326262 7:108221701-108221723 GAAGGGTGGAGGAGTGTTGAGGG + Intronic
1030783080 7:113625744-113625766 GAAGGGGGAAGGAGAGGAGAGGG - Intergenic
1034455891 7:151169581-151169603 GAAGGGGGCAGGACTCAAGAAGG + Intronic
1035014550 7:155753681-155753703 GAAGGGAGACTGAGTGTAAATGG + Intronic
1035638742 8:1166224-1166246 GAAGGCAGCAGGAGGGTAGAAGG - Intergenic
1035702415 8:1646795-1646817 GAAGGGGGCCAGAGGGCAAACGG + Intronic
1036662460 8:10716834-10716856 GAAGGGGCCGGGAGTGCAGGCGG - Intergenic
1037480658 8:19302236-19302258 GAAGGGGGAGAGAGGGTAGAAGG + Intergenic
1038415634 8:27393187-27393209 GAGGTGGGCAGGAGTGAAGATGG - Intronic
1038660097 8:29489898-29489920 CAAGGGGGCCAGAGTGGGGAAGG - Intergenic
1039521177 8:38173368-38173390 GAAGGGGGCGGGGGGGGAGAAGG + Intronic
1042140747 8:65676131-65676153 GAAGGGGGAAGGAGTGAAAATGG - Intronic
1042643697 8:70962351-70962373 GAAGGAGGCAGGAGGGAAGAGGG - Intergenic
1044367797 8:91369972-91369994 GAAGGGAGGAGGAGAGTAGAGGG - Intronic
1045405936 8:101866963-101866985 GAAGGGAGCCAGAGCATAGAGGG - Intronic
1045884936 8:107084450-107084472 GATGTGGGCCAGAGTGTAGGGGG + Intergenic
1048928039 8:139288099-139288121 AAAGGGAGCCAGAGTGCAGATGG - Intergenic
1049212547 8:141393352-141393374 GAGGGGGGCCGGCGTGGTGATGG - Intronic
1056458373 9:86785294-86785316 GAAGGGGGCAGCAATGGAGAAGG - Intergenic
1056691323 9:88810987-88811009 GGAGGGAGCCTGAGGGTAGAAGG - Intergenic
1057050456 9:91919743-91919765 GGTGGGGGCCGGAGTGGGGAGGG + Intronic
1057669839 9:97077567-97077589 GAAGGTGGCCGGACTGTCGCGGG + Intergenic
1060909052 9:127334175-127334197 GATGGGGGCCTGAGTGGGGAAGG + Intronic
1061282000 9:129602815-129602837 GAAGGGGGCAAGAATGTGGAGGG + Intergenic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1061821277 9:133228313-133228335 GGAGGGGGCCGGGGTGCAGAAGG - Intergenic
1062108683 9:134769835-134769857 GAAGGGGGCCTGGGTGTGAAGGG + Intronic
1185821540 X:3209370-3209392 GAAGTGGGCCTGATTGAAGAAGG + Intergenic
1186269180 X:7866455-7866477 GAAGGGGGCAGGAGGGGAGGAGG - Intergenic
1186646892 X:11516835-11516857 GAAGGAGGCTGGAGTCTAGAAGG - Intronic
1188622159 X:32239419-32239441 GAAGGGGGCCAGAGAGTATACGG - Intronic
1190753408 X:53381069-53381091 GAAGGGGGCTGGCTTGTAGCTGG + Exonic
1199894952 X:152119356-152119378 GATGGGGTTAGGAGTGTAGATGG + Intergenic