ID: 1113867198

View in Genome Browser
Species Human (GRCh38)
Location 13:113534676-113534698
Sequence GCTGCTGGAGAGACTGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11063
Summary {0: 1, 1: 1, 2: 33, 3: 857, 4: 10171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113867194_1113867198 12 Left 1113867194 13:113534641-113534663 CCAGCTGGGGCGTGGTCGCGCTC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1113867198 13:113534676-113534698 GCTGCTGGAGAGACTGAGCTGGG 0: 1
1: 1
2: 33
3: 857
4: 10171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113867198 Original CRISPR GCTGCTGGAGAGACTGAGCT GGG Intronic
Too many off-targets to display for this crispr