ID: 1113868594

View in Genome Browser
Species Human (GRCh38)
Location 13:113544658-113544680
Sequence CATGGCCCTCGCCAGACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113868594_1113868595 -7 Left 1113868594 13:113544658-113544680 CCAGGTGTCTGGCGAGGGCCATG 0: 1
1: 0
2: 1
3: 14
4: 165
Right 1113868595 13:113544674-113544696 GGCCATGCCTGCTCCACAGATGG 0: 1
1: 0
2: 2
3: 27
4: 221
1113868594_1113868598 3 Left 1113868594 13:113544658-113544680 CCAGGTGTCTGGCGAGGGCCATG 0: 1
1: 0
2: 1
3: 14
4: 165
Right 1113868598 13:113544684-113544706 GCTCCACAGATGGTGCCTCCTGG 0: 1
1: 0
2: 0
3: 21
4: 229
1113868594_1113868601 18 Left 1113868594 13:113544658-113544680 CCAGGTGTCTGGCGAGGGCCATG 0: 1
1: 0
2: 1
3: 14
4: 165
Right 1113868601 13:113544699-113544721 CCTCCTGGCTGTGTCATCCGTGG 0: 1
1: 0
2: 3
3: 38
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113868594 Original CRISPR CATGGCCCTCGCCAGACACC TGG (reversed) Intronic