ID: 1113870685

View in Genome Browser
Species Human (GRCh38)
Location 13:113558104-113558126
Sequence CGGAAGATGGAAATTCAACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 82}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113870685_1113870687 -9 Left 1113870685 13:113558104-113558126 CCGGGTTGAATTTCCATCTTCCG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1113870687 13:113558118-113558140 CATCTTCCGCTAGAAGAACTAGG 0: 1
1: 0
2: 0
3: 8
4: 66
1113870685_1113870698 29 Left 1113870685 13:113558104-113558126 CCGGGTTGAATTTCCATCTTCCG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1113870698 13:113558156-113558178 TTCCCTGGTTCCCAGTGGGCGGG 0: 1
1: 0
2: 2
3: 22
4: 251
1113870685_1113870699 30 Left 1113870685 13:113558104-113558126 CCGGGTTGAATTTCCATCTTCCG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1113870699 13:113558157-113558179 TCCCTGGTTCCCAGTGGGCGGGG 0: 1
1: 0
2: 1
3: 17
4: 233
1113870685_1113870695 24 Left 1113870685 13:113558104-113558126 CCGGGTTGAATTTCCATCTTCCG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1113870695 13:113558151-113558173 GCTGTTTCCCTGGTTCCCAGTGG 0: 1
1: 0
2: 3
3: 23
4: 286
1113870685_1113870692 14 Left 1113870685 13:113558104-113558126 CCGGGTTGAATTTCCATCTTCCG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1113870692 13:113558141-113558163 GGTTGCCCAGGCTGTTTCCCTGG 0: 1
1: 0
2: 5
3: 47
4: 367
1113870685_1113870697 28 Left 1113870685 13:113558104-113558126 CCGGGTTGAATTTCCATCTTCCG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1113870697 13:113558155-113558177 TTTCCCTGGTTCCCAGTGGGCGG 0: 1
1: 0
2: 0
3: 26
4: 230
1113870685_1113870696 25 Left 1113870685 13:113558104-113558126 CCGGGTTGAATTTCCATCTTCCG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1113870696 13:113558152-113558174 CTGTTTCCCTGGTTCCCAGTGGG 0: 1
1: 0
2: 4
3: 27
4: 279
1113870685_1113870691 2 Left 1113870685 13:113558104-113558126 CCGGGTTGAATTTCCATCTTCCG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1113870691 13:113558129-113558151 AGAAGAACTAGGGGTTGCCCAGG 0: 1
1: 0
2: 0
3: 20
4: 200
1113870685_1113870688 -8 Left 1113870685 13:113558104-113558126 CCGGGTTGAATTTCCATCTTCCG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1113870688 13:113558119-113558141 ATCTTCCGCTAGAAGAACTAGGG 0: 1
1: 0
2: 0
3: 5
4: 62
1113870685_1113870689 -7 Left 1113870685 13:113558104-113558126 CCGGGTTGAATTTCCATCTTCCG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1113870689 13:113558120-113558142 TCTTCCGCTAGAAGAACTAGGGG 0: 1
1: 0
2: 0
3: 5
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113870685 Original CRISPR CGGAAGATGGAAATTCAACC CGG (reversed) Intergenic
903436595 1:23354636-23354658 CAGAAAATAGAAATTCAACAAGG + Intergenic
904860507 1:33534039-33534061 AGGAAGAAGAAAATTTAACCAGG - Intronic
905028817 1:34868172-34868194 CAGAAGAGGGAGATTCAGCCAGG - Intronic
909891282 1:81010272-81010294 AGGAAGATGGAAAATCACCAAGG + Intergenic
910456220 1:87399829-87399851 GGGAAGATGCAATTTCAGCCGGG + Intergenic
913518909 1:119627334-119627356 CGCAAGTTGGAAATTCCAGCTGG + Intronic
1071451258 10:85793124-85793146 AGGAAGATGGAAATTGGACGTGG - Intronic
1074259391 10:111836595-111836617 CAGAAAAGGGAAATTCAACTGGG - Intergenic
1074696166 10:116051735-116051757 TGGAAGAAGGAAAATAAACCAGG + Intergenic
1074913399 10:117932919-117932941 GGGAAAATGGAAATTAAAACAGG - Intergenic
1077947820 11:6921528-6921550 GGGAAGATGGAAAGTAAAGCTGG - Exonic
1078740260 11:14059635-14059657 GGGAAAATGGAAATGCAGCCTGG - Intronic
1079730746 11:23935947-23935969 GGGTAGATAGAAATTCACCCTGG + Intergenic
1081359995 11:42164335-42164357 AGAAAGAAGGAAATTCAACAGGG + Intergenic
1081765768 11:45609041-45609063 AGGCAGAGGGAAATTCAAGCTGG + Intergenic
1091317281 11:134623476-134623498 CTGAAGATGGAGATGCTACCAGG - Intergenic
1091976027 12:4826338-4826360 TGGAAGAAGGAATTTCAGCCTGG - Intronic
1097758371 12:63432275-63432297 TGGAAAATGAAAATTCAAACAGG + Intergenic
1099397656 12:82160743-82160765 CAGGAGATGGGAATTCAACAGGG - Intergenic
1101659086 12:106750112-106750134 AGGGAGAAGGAAAATCAACCTGG + Intronic
1108167913 13:47711908-47711930 CGGAAAAGGGAAACTCATCCTGG - Intergenic
1108302993 13:49099213-49099235 TGGAAGCTGGAAATTCAAAATGG - Intronic
1111455089 13:88471825-88471847 AGGAAAATGCAAATTCAAACTGG + Intergenic
1113336009 13:109376546-109376568 GGGAATAAGGAAATTCACCCAGG - Intergenic
1113870685 13:113558104-113558126 CGGAAGATGGAAATTCAACCCGG - Intergenic
1115908315 14:38226388-38226410 AGGAAGATGGAAGGTCAACCAGG + Intergenic
1119183084 14:72617498-72617520 AGGAAGATGAAAATTCCATCCGG + Intergenic
1129965951 15:79735765-79735787 AAGAAGATTGAAATTCAAACTGG - Intergenic
1135245272 16:20851110-20851132 CGGAAGTTGGCAATTCACCTAGG - Intronic
1142267018 16:89068745-89068767 AAGGAGCTGGAAATTCAACCTGG + Intergenic
1144653228 17:17019806-17019828 AGGGAGAAGGAAATTGAACCAGG + Intergenic
1153329023 18:3853655-3853677 AGTAAGATGGAAACACAACCAGG - Intronic
1158503617 18:58026478-58026500 CTGAAGTGGGAAATTCATCCTGG + Intergenic
1164596334 19:29532946-29532968 GGGAAGAGGGAGATTCAAGCAGG - Intronic
925151997 2:1621223-1621245 CGAAAGATGGAAATCCAGCAAGG - Intergenic
926515962 2:13846334-13846356 GGGAAGAATGAAATTTAACCAGG - Intergenic
932568755 2:72925568-72925590 CGGAAGGTGAAAAGTCAGCCGGG - Intronic
936395093 2:112120572-112120594 CGCAAGATGGAAATAAACCCCGG - Intergenic
944298323 2:198092715-198092737 AGGAAGATGGAAATAAAACATGG - Intronic
946057380 2:216913945-216913967 CAGAAGATGTGCATTCAACCTGG - Intergenic
948020325 2:234727039-234727061 AGAGAGATGGAAATTCAAACAGG + Intergenic
1168892489 20:1303918-1303940 AGGAAGAAGGAAAATCATCCAGG - Intronic
1175262209 20:57681741-57681763 CAGAAGAAGGAACTGCAACCTGG + Intronic
1175428276 20:58884621-58884643 TTGAAGATGGAAACTCATCCAGG - Intronic
1175643700 20:60653054-60653076 GGGAAGCTGGAACTTCTACCAGG - Intergenic
1178775827 21:35549519-35549541 AGGTAGATGGAATTTAAACCAGG - Intronic
1181957779 22:26600776-26600798 CAGAGGATGGAACTTAAACCAGG - Intronic
952077997 3:29721854-29721876 ATGAAGATGGACATTCAAACTGG - Intronic
954888229 3:53896670-53896692 CAGAAGATGGAAATTCAGAGAGG - Intergenic
958788485 3:98624550-98624572 TGGAAGATGGGCATTCCACCTGG - Intergenic
960580609 3:119275496-119275518 CGGAAGGTTGAAATGCATCCTGG - Intergenic
962113502 3:132475657-132475679 TGGAATATGGAAATGCAACTGGG - Intronic
963722124 3:148873713-148873735 CAGAAGTTGGAATTTGAACCTGG - Intronic
965998155 3:174912272-174912294 AGGAAGATGGAATGTCAACATGG + Intronic
966205813 3:177405320-177405342 GGGGAGATGGAAATTCAGTCAGG - Intergenic
968266399 3:197366729-197366751 AAGAAGTTGGAAATTCAAACTGG + Intergenic
970622336 4:17836060-17836082 CTGAAGATGGAAATTTAAAATGG - Intronic
971886132 4:32450590-32450612 AGGAAGATGGTAATTGAACTAGG - Intergenic
975817014 4:78228674-78228696 TGGAAGCTGGAAATTCCAGCAGG + Intronic
981992407 4:150938436-150938458 TGGAAGAAGGAAATATAACCTGG - Intronic
989150248 5:38291842-38291864 CCGAAGAGGGAAATTCCACCTGG + Intronic
1000141255 5:158405266-158405288 AGGAAGATGTTAATTCAAACTGG - Intergenic
1000435375 5:161201305-161201327 GGGAAGATTGAAAATTAACCAGG + Intergenic
1003996407 6:11545224-11545246 GGGAGGCTGGGAATTCAACCTGG + Intronic
1011237358 6:85232076-85232098 CACAAGATGGAAACTCAACATGG - Intergenic
1018079125 6:160243677-160243699 AGGCAGCTGGGAATTCAACCAGG + Exonic
1018969827 6:168519348-168519370 TGGAAGAAGAAAATCCAACCTGG - Intronic
1020215509 7:6187061-6187083 GGGAAGAAAGAAATTCAACATGG - Exonic
1026743179 7:72991403-72991425 CGGGAGATCAAAATTTAACCTGG - Intergenic
1027029293 7:74876100-74876122 CGGGAGATCAAAATTTAACCTGG - Intergenic
1027100556 7:75373675-75373697 CGGGAGATCAAAATTTAACCTGG + Intergenic
1028221691 7:88204457-88204479 CAGGAGATGGAAATGCAAGCAGG - Intergenic
1029631578 7:101754454-101754476 GGGAACATGGAAATTCAGACAGG - Intergenic
1030979840 7:116173586-116173608 GGGAAGATGGAGATTGAAGCCGG - Intergenic
1031018194 7:116598062-116598084 AGGAAGATGGAAATTTCACTGGG + Intergenic
1033491811 7:141851735-141851757 CAGAAGATTCAAATTCAAACTGG + Intergenic
1036637061 8:10558433-10558455 ATGAAGATGGAGATGCAACCAGG - Intergenic
1037434218 8:18845795-18845817 CGGAAGAAGGGAACTCAAACTGG + Intronic
1039413800 8:37376878-37376900 CAGAAGATCGCTATTCAACCCGG + Intergenic
1040836497 8:51737108-51737130 GGGCAGCTGGAAATTCAAACTGG - Intronic
1044898699 8:96921145-96921167 GGGCAGGTGGAAATTGAACCTGG + Intronic
1050778688 9:9302504-9302526 CGGAACATGGAAATATAAGCAGG - Intronic
1057506769 9:95640457-95640479 CTGAAGATGGATTTTCAACTTGG + Intergenic
1059702620 9:116790395-116790417 CGGAGGATGGACATTCCAACAGG - Intronic
1060701594 9:125756240-125756262 TGGAAGATGGAATTTCATACTGG + Intronic
1191089621 X:56606222-56606244 AGGAAGATGGAAATTCAGCATGG - Intergenic