ID: 1113870688

View in Genome Browser
Species Human (GRCh38)
Location 13:113558119-113558141
Sequence ATCTTCCGCTAGAAGAACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 62}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113870685_1113870688 -8 Left 1113870685 13:113558104-113558126 CCGGGTTGAATTTCCATCTTCCG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1113870688 13:113558119-113558141 ATCTTCCGCTAGAAGAACTAGGG 0: 1
1: 0
2: 0
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113870688 Original CRISPR ATCTTCCGCTAGAAGAACTA GGG Intergenic
912704087 1:111899090-111899112 ATCTTCAGCAAGAAGCACTGTGG - Intronic
917003974 1:170391189-170391211 ATCTTTAGCTAGATGAACTAAGG - Intergenic
923340270 1:233000832-233000854 ATATTCCACTAGAAGAAAGATGG - Intronic
923519185 1:234722818-234722840 GTCTTCAGCGAGAAGGACTAGGG - Intergenic
924477489 1:244394833-244394855 ATCTTCCTCTTGAAGACCTCTGG + Intergenic
1065085447 10:22170223-22170245 ATCTTTAGCTAGAATGACTAAGG + Intergenic
1067493785 10:46742445-46742467 ATCTTAAGCTAAAAGAACAAAGG - Intergenic
1067600874 10:47597960-47597982 ATCTTAAGCTAAAAGAACAAAGG + Intergenic
1069053773 10:63822337-63822359 ATCCTCAGCTAGAAGATGTATGG + Intergenic
1069072910 10:64008091-64008113 ATATTCCCCAAGAAGAACCAGGG + Intergenic
1071652416 10:87405827-87405849 ATCTTAAGCTAAAAGAACAAAGG + Intergenic
1085532697 11:77201371-77201393 ATCTTCCCACAGAAGAACTGAGG - Intronic
1091052216 11:132383118-132383140 ATTTTTAGCTAGAATAACTAAGG + Intergenic
1106175715 13:27329508-27329530 ATCTTCAGAGGGAAGAACTAAGG - Intergenic
1108918160 13:55641881-55641903 GACTTCCACCAGAAGAACTAGGG - Intergenic
1113847042 13:113398164-113398186 ATCTTCTCCTAGAAGAACAAAGG - Intergenic
1113870688 13:113558119-113558141 ATCTTCCGCTAGAAGAACTAGGG + Intergenic
1115759995 14:36570500-36570522 AACTTCCAGAAGAAGAACTATGG - Intergenic
1116836299 14:49771625-49771647 ATCTGCCTAGAGAAGAACTATGG + Exonic
1126458215 15:48887746-48887768 ACCTTTAGCTAGATGAACTAAGG + Intronic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1130174588 15:81555033-81555055 ATATTCTGCTAGAAGCAGTAGGG - Intergenic
1132136077 15:99340584-99340606 ATCTGCAGTTTGAAGAACTATGG + Intronic
1155739181 18:29265455-29265477 ATCTTAGGCTAGAAAAACTCTGG - Intergenic
925627300 2:5853960-5853982 AGCTTCAGCAAGAAGAGCTAGGG + Intergenic
929628312 2:43433062-43433084 ATCTTCCTCTAGAAGCTTTATGG + Intronic
929674498 2:43911975-43911997 ATCATACGGAAGAAGAACTAAGG + Intronic
936551315 2:113443272-113443294 ACCTTCCTCAAGATGAACTAGGG + Intronic
941246433 2:163103397-163103419 TTCTTCTGCTAGAAAAAATAAGG - Intergenic
1173605535 20:44328340-44328362 ACCTTCCTGTAGAAGAACTACGG - Intergenic
955822465 3:62910443-62910465 AACTTCCACTATAAGAACCACGG - Intergenic
959146563 3:102553155-102553177 ATGTTCCTCTGGAAGAAATAGGG + Intergenic
963342139 3:144049174-144049196 ATATTCCTTTAGAAGAACAAAGG + Intergenic
964748195 3:160031223-160031245 ATCTTCAGCAAAAGGAACTATGG + Intronic
970648862 4:18155898-18155920 TTCCTCCCCTAGAAGAAGTAAGG + Intergenic
987241756 5:16007099-16007121 ATCTTCCTCAAGAAGACATAAGG + Intergenic
988206928 5:28149702-28149724 ATCTTCTACTTGGAGAACTATGG - Intergenic
990405723 5:55488735-55488757 GTCTTCAGGTAGTAGAACTAAGG + Intronic
993330646 5:86595960-86595982 ATCATTGCCTAGAAGAACTATGG - Intergenic
993802692 5:92363294-92363316 AGCTTCCCCTAAAAGAACGATGG + Intergenic
995138830 5:108710354-108710376 CACTCCCGCTAGAAGATCTAGGG + Intergenic
996521678 5:124434456-124434478 ATCTTGAATTAGAAGAACTAAGG + Intergenic
998506453 5:142676118-142676140 ATCTTCCCCTGGAAGAAAAAAGG + Intronic
1005012813 6:21351846-21351868 ATCTTTGGCTGGTAGAACTAAGG - Intergenic
1010740642 6:79499632-79499654 ATCTTCGGCTGGCAGGACTATGG + Intronic
1014623272 6:123695694-123695716 TTCTTCAGCTTGAAGATCTAAGG - Intergenic
1016120307 6:140335908-140335930 ATTTTCCTCTAGAACAACTCTGG + Intergenic
1017292220 6:152752128-152752150 ATCTTTGGCTGGAAGAACTGAGG + Intronic
1021038511 7:15831394-15831416 AACTTTCCCTAGAAGAACTAAGG - Intergenic
1021429648 7:20546284-20546306 ATCTGCCGGTAGAATAACAAAGG + Intergenic
1021960233 7:25863158-25863180 ATTTTCCACTAGCAGAGCTAGGG + Intergenic
1024917515 7:54518482-54518504 ACCTTTAGCTAGAATAACTAAGG - Intergenic
1033824728 7:145175482-145175504 AGCTTCAGATAGAAGAACTCTGG + Intergenic
1039594360 8:38777949-38777971 TTCTTTTGCTAGAAGAAATAAGG + Intronic
1039667729 8:39553965-39553987 ATTTTCCACTAAAAGAAATATGG + Intergenic
1044765494 8:95568577-95568599 ATCTTAAGCAAGAAGAACAAAGG - Intergenic
1048151432 8:131899040-131899062 ATGTACCGCAAGAAGCACTAGGG + Intergenic
1048374210 8:133808155-133808177 ATCTTCCAATGGGAGAACTAAGG + Intergenic
1048746466 8:137619778-137619800 ACCTTCCACCTGAAGAACTAGGG - Intergenic
1049901676 9:173839-173861 ACCTTCCTCAAGATGAACTAGGG - Intronic
1051973634 9:22922087-22922109 ACCTTCCATTAGAACAACTAGGG - Intergenic
1055011147 9:71566815-71566837 ATCTTAAGCTAGCAGAACTATGG - Intergenic
1056175620 9:84032080-84032102 ATTTTCCACTAAAAGAAGTAAGG - Intergenic
1059025681 9:110626476-110626498 AACTTCCGCAGGAAAAACTAAGG + Intergenic
1187954180 X:24499615-24499637 ATGTTCCATAAGAAGAACTAGGG + Intronic
1192633737 X:72798002-72798024 ATCTTTAGCTAGACTAACTAAGG - Intronic
1192647973 X:72922799-72922821 ATCTTTAGCTAGACTAACTAAGG + Intronic
1194693784 X:97019842-97019864 GTCTTCTGCTAAAAAAACTAAGG + Intronic