ID: 1113871408

View in Genome Browser
Species Human (GRCh38)
Location 13:113562087-113562109
Sequence CTGTGAGGGCCTCTGGCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113871401_1113871408 0 Left 1113871401 13:113562064-113562086 CCAGGTCGCAGGTGAAGGCCCAG No data
Right 1113871408 13:113562087-113562109 CTGTGAGGGCCTCTGGCAAAGGG No data
1113871400_1113871408 1 Left 1113871400 13:113562063-113562085 CCCAGGTCGCAGGTGAAGGCCCA No data
Right 1113871408 13:113562087-113562109 CTGTGAGGGCCTCTGGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113871408 Original CRISPR CTGTGAGGGCCTCTGGCAAA GGG Intergenic
No off target data available for this crispr