ID: 1113874609

View in Genome Browser
Species Human (GRCh38)
Location 13:113586151-113586173
Sequence CTTAATTAAATTGAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 215}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113874603_1113874609 22 Left 1113874603 13:113586106-113586128 CCTTATCTTTACCGACTGTGTTA 0: 1
1: 0
2: 1
3: 8
4: 95
Right 1113874609 13:113586151-113586173 CTTAATTAAATTGAGGTGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 215
1113874604_1113874609 11 Left 1113874604 13:113586117-113586139 CCGACTGTGTTAATTGATAATTT 0: 1
1: 0
2: 2
3: 20
4: 281
Right 1113874609 13:113586151-113586173 CTTAATTAAATTGAGGTGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113874609 Original CRISPR CTTAATTAAATTGAGGTGGA GGG Intronic
900334481 1:2154950-2154972 CACAAGGAAATTGAGGTGGAGGG - Intronic
903741538 1:25561472-25561494 CTCAATTAAATTGAGTTGTCTGG + Intronic
907708550 1:56854126-56854148 TTAAATTAAATTGAGATGGATGG - Intergenic
908146058 1:61245235-61245257 CAGAATTAAATTGAGGGGCATGG + Intronic
908664301 1:66472947-66472969 CTTCAAAAAATTGAGGAGGAGGG - Intergenic
909402310 1:75247795-75247817 CTTAATAATGTTGAGGTCGATGG + Intronic
910151380 1:84150927-84150949 CTTAATAAAGCTGAGGGGGAGGG - Intronic
911354856 1:96803538-96803560 CTGAATTAAAAAGAGATGGAGGG + Intronic
911680988 1:100715337-100715359 CTTAATTAAATAGAGGTCTACGG - Intergenic
912063123 1:105698935-105698957 ATTAATTTTATTAAGGTGGAAGG + Intergenic
916351715 1:163857354-163857376 CTTCATCAAATTGGGGTGGGCGG - Intergenic
917203098 1:172538150-172538172 TTTAATTAGATTGCTGTGGAGGG + Intronic
918650530 1:186956885-186956907 ATTAATAATATTGAGGAGGACGG + Intronic
918779200 1:188674605-188674627 AAAAATGAAATTGAGGTGGAGGG - Intergenic
918848109 1:189645017-189645039 CCTAAATAAATAGAGGTGTAGGG + Intergenic
920005340 1:202829132-202829154 GTTAATTATTTTGAGGGGGATGG - Intergenic
921507660 1:215992071-215992093 TTTAATTAAAATGAGATGGCTGG + Intronic
921719704 1:218457020-218457042 CTTATTCAAATTGAGATGTATGG - Intergenic
924026062 1:239833906-239833928 TTTATTTAAATTGAGCAGGAAGG - Intronic
924864598 1:247964042-247964064 AGTAATTACATTCAGGTGGAAGG - Intronic
1063888680 10:10606414-10606436 ATTAATTAAATTAAAGTGGTGGG + Intergenic
1065890291 10:30115583-30115605 CTTGATTCACTTGAGGTGGATGG - Intergenic
1067745142 10:48929869-48929891 CTTTATTAATTGGGGGTGGATGG - Intronic
1068269862 10:54707159-54707181 CTAGAGTAAATTGAGGTGGTAGG + Intronic
1068340624 10:55697588-55697610 TTTAATTAAGATGAGGTGAAAGG + Intergenic
1068610300 10:59052628-59052650 CTTCATTGAGTTGAGGGGGATGG - Intergenic
1069767525 10:70874237-70874259 TTTAAGTATATTGAGGGGGAAGG + Intronic
1070276120 10:75008901-75008923 CATAATTAAATAGCTGTGGAAGG + Intronic
1071456019 10:85852268-85852290 CTGAATGTAATTGAGTTGGAAGG - Intronic
1073213331 10:101822149-101822171 ATTGATTAAATGGGGGTGGAGGG + Intergenic
1073383693 10:103103352-103103374 TTTAATAAAAGTAAGGTGGAAGG + Intronic
1075085742 10:119413238-119413260 CTTAATTAAAACCAGATGGAGGG - Intronic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1079288351 11:19161459-19161481 ATGAATAAAATTGATGTGGAAGG + Intronic
1079928775 11:26531126-26531148 CTTAAGTGAATTGTAGTGGAAGG + Intronic
1080212365 11:29801112-29801134 CTTAATTAAGTTAACCTGGAAGG - Intergenic
1080822966 11:35824605-35824627 CTTAAGAAAGGTGAGGTGGAGGG - Intergenic
1082633241 11:55565380-55565402 CTTAGTAAAATTAAGGTTGAAGG + Intergenic
1089019482 11:115197963-115197985 CTTAGTAAAGTTGAGATGGAAGG - Intronic
1089141307 11:116286825-116286847 CTTAATAAAAATTAGATGGATGG - Intergenic
1091528941 12:1335759-1335781 TTCAAATAAATTGAGGAGGAGGG - Intronic
1091733613 12:2900295-2900317 CTAAATGAAATTGAGGAGAAAGG - Intronic
1093667982 12:21837048-21837070 CTTAAATAAATTGAATTGAAAGG + Intronic
1095972080 12:47909125-47909147 CTTTAGGAAGTTGAGGTGGAAGG + Intronic
1097885789 12:64727749-64727771 ATTGATTAAATTGTGGTGCAGGG - Intronic
1098824196 12:75272089-75272111 CTTATTGGAATTGAGCTGGAGGG + Intergenic
1099315167 12:81075158-81075180 TTTAATTAATTTGAGGTACAAGG - Intronic
1100033009 12:90215843-90215865 CTTAATAAATTTAAGGTGAAGGG - Intergenic
1102097655 12:110253042-110253064 CTTAATTTGATTAAGGAGGAAGG - Intergenic
1102885842 12:116521233-116521255 TTTAATTAAATTCAGTTGGCTGG + Intergenic
1106987776 13:35375513-35375535 CATAATTCAGTTAAGGTGGAAGG - Intronic
1108041863 13:46346704-46346726 TTTAATTAAATTTTGGGGGAAGG - Intronic
1108097516 13:46919296-46919318 TTTAAAAAAATTGAGGAGGAGGG - Intergenic
1109533811 13:63689162-63689184 GTTGATAAAATTGAAGTGGATGG + Intergenic
1109570478 13:64182377-64182399 TTTATTGAAAATGAGGTGGATGG - Intergenic
1109604110 13:64669566-64669588 CATAATTAAATTGAGGATAATGG + Intergenic
1111217314 13:85161220-85161242 CATAACTAAAATGAAGTGGAAGG - Intergenic
1111797124 13:92936200-92936222 TTTAATTAATTTGAGGTGTTTGG + Intergenic
1112330095 13:98470485-98470507 AGCAATTAAAATGAGGTGGAAGG + Intronic
1113874609 13:113586151-113586173 CTTAATTAAATTGAGGTGGAGGG + Intronic
1116644704 14:47511817-47511839 CTTCATTGAATTGAGGAGAAAGG + Intronic
1118749333 14:68795062-68795084 ATGATTTAAATTAAGGTGGATGG - Intronic
1120306031 14:82771715-82771737 CTTCAAAAAATTGAGGAGGAGGG - Intergenic
1123802516 15:23836014-23836036 CATAATTACATTTAGATGGAAGG - Intergenic
1125068581 15:35523859-35523881 CTAAATTGAATTGATTTGGATGG - Intronic
1125192604 15:37010754-37010776 CTTAATTGAATGGGGGTTGAGGG + Intronic
1126599704 15:50416621-50416643 CTTTAGGAAACTGAGGTGGAAGG - Intergenic
1126971380 15:54116034-54116056 TATAATTAAAATGATGTGGATGG - Intronic
1130190333 15:81728868-81728890 CTGAATTAAAATGAAGTGTAAGG + Intergenic
1130260596 15:82351331-82351353 CTTAATTCTATTAACGTGGAAGG - Intergenic
1130280638 15:82517676-82517698 CTTAATTCTATTAACGTGGAAGG + Intergenic
1130472010 15:84233859-84233881 CTTAATTCTATTAACGTGGAAGG + Intergenic
1130479504 15:84348430-84348452 CTTAATTCTATTAACGTGGAAGG + Intergenic
1130492266 15:84439699-84439721 CTTAATTCTATTAACGTGGAAGG - Intergenic
1133192320 16:4143321-4143343 CTTGATGAAAGTGAGATGGAAGG - Intergenic
1133564483 16:6980583-6980605 TTTAATAAAATGGAGGTGGCAGG + Intronic
1135038284 16:19096679-19096701 ATAAAATAAATTGAGGTGGGAGG + Intergenic
1136599685 16:31276755-31276777 CTTCATTAAATTGCGGGGGTGGG + Intronic
1137299285 16:47131813-47131835 CTCAGTTAAATTGAGGCTGATGG + Intronic
1139575753 16:67841228-67841250 CTCAAATAAGTTGAGGTGGGGGG + Intronic
1141269072 16:82522528-82522550 CTGAAGTAAATGGTGGTGGAGGG + Intergenic
1144326223 17:14183741-14183763 CCTATTTAAATAGAGCTGGAGGG - Intronic
1144475100 17:15580617-15580639 CCTATTTAAATAGAGCTGGAGGG - Intronic
1148261449 17:46187265-46187287 CTTGGTTAAATTCAGTTGGAAGG - Intronic
1149454273 17:56775045-56775067 CTTAATTCAAGTGGGGTGGCTGG - Intergenic
1151418951 17:73985003-73985025 TTTAATAAACGTGAGGTGGATGG - Intergenic
1155719669 18:28995330-28995352 CTTAGTTAATTTGTGGAGGAGGG + Intergenic
1157400111 18:47380174-47380196 AGTAATTAAAATGAGGTGGTAGG - Intergenic
1158184719 18:54758894-54758916 CTCATTTAAAATGAGGTTGAGGG + Intronic
1158831683 18:61286544-61286566 CTAAATTAAATTGGAGAGGATGG + Intergenic
1159038763 18:63302898-63302920 CCAAATTAAACTGAGGGGGATGG + Intronic
1160052099 18:75443402-75443424 CATAAAAAAATAGAGGTGGAAGG + Intergenic
1161388574 19:4009568-4009590 CTTGATTTAATTGGGGTGGGGGG - Intronic
1161602739 19:5194678-5194700 ATTAATAAAACTGGGGTGGATGG + Intronic
1164881499 19:31735956-31735978 ATGAATTAAATTAAGTTGGATGG - Intergenic
1166669060 19:44698871-44698893 CTACTTTAAATTGGGGTGGAGGG - Intergenic
1168135802 19:54350575-54350597 ACTAAATAAATTGAGCTGGATGG + Intergenic
925674532 2:6346954-6346976 CTGAATTACCTGGAGGTGGAAGG + Intergenic
928358566 2:30644423-30644445 CTTAATTCAATTGTGGTGCCTGG - Intergenic
928712760 2:34025780-34025802 CTTGTTTACATTGAGGTGGTTGG + Intergenic
929384825 2:41394174-41394196 CTTAGATAAAGTGAGGTAGAGGG - Intergenic
929462434 2:42112894-42112916 CTTGATTAAATCTAGGTGGTGGG - Intergenic
930997058 2:57732705-57732727 CTTAATTAAATTCAAGGGGAGGG + Intergenic
933405798 2:81857907-81857929 CTTAATTATATTGTGGTCTATGG + Intergenic
933466874 2:82662862-82662884 CTTTATTAATTTGAGGATGAGGG + Intergenic
936657435 2:114504755-114504777 TTAAATTAAACTGAGGTGGCTGG + Intronic
937521127 2:122713126-122713148 CTCAATGAAATTCAGGAGGATGG + Intergenic
937865191 2:126745675-126745697 TTTAAAAAAATTGAGGTGGCTGG - Intergenic
939129169 2:138213633-138213655 CTCAATTAAATTCAGGTGAATGG + Intergenic
939210978 2:139174584-139174606 TTTAATAAAATTGAAGTAGATGG + Intergenic
939228464 2:139394608-139394630 CTTATTCAAATTGATGTAGAAGG + Intergenic
939589338 2:144044376-144044398 TTTTATGAAATTGAGATGGACGG - Intronic
940354381 2:152722600-152722622 CTTAATAAGATTGAGGTGATCGG + Intronic
940840120 2:158570110-158570132 ATTAAGTAAATTGTGGTAGATGG + Intronic
942224214 2:173801096-173801118 CCAAATTAAAATGAGCTGGAAGG - Intergenic
943433370 2:187832015-187832037 CTTAATTTAAATGAGTTGTATGG + Intergenic
943554218 2:189382246-189382268 ATTAAAAATATTGAGGTGGAAGG + Intergenic
945815294 2:214598585-214598607 ATTTATTAAATTTAGGTGGCGGG + Intergenic
947345085 2:229182346-229182368 CTCAGCAAAATTGAGGTGGAAGG - Intronic
948671539 2:239571695-239571717 CTTAATTAAAAGGAGGATGAGGG + Intergenic
948719113 2:239885722-239885744 CTTAATAAAACTGAGAGGGAAGG - Intergenic
1170508409 20:17052796-17052818 CTTCAAAAAATTGAGGAGGAGGG - Intergenic
1171315553 20:24189807-24189829 ATTAAGTAAATGGTGGTGGATGG - Intergenic
1172561955 20:35896951-35896973 GCTAACTAAATGGAGGTGGAAGG - Intronic
1173047582 20:39527437-39527459 TTTCATGAAATAGAGGTGGAAGG + Intergenic
1174947549 20:55004925-55004947 CTACATAAAATAGAGGTGGAAGG + Intergenic
1175012704 20:55755943-55755965 CTTTATTCAATTTAGGTGGAGGG - Intergenic
1176285820 21:5018967-5018989 CGGGATTAAATTGAGGTGGAAGG + Intergenic
1176990256 21:15487384-15487406 CTAAATTAAATTATGTTGGAGGG + Intergenic
1177261942 21:18740753-18740775 ATTAATAAAATTTAGGTAGAGGG + Intergenic
1177656535 21:24023585-24023607 TTTAATTATATTGAGGAGAAGGG + Intergenic
1179871361 21:44244508-44244530 CGGGATTAAATTGAGGTGGAAGG - Intergenic
1180629459 22:17218213-17218235 ATTAAGTAAATAGAGGTGCAAGG + Intronic
1181498713 22:23303029-23303051 GTGAATTAAATTGGGGTGGGGGG - Intronic
1183355525 22:37356993-37357015 CTTAAGTAAAATCAGGAGGACGG + Intergenic
952352779 3:32556651-32556673 ATTACTTAAGCTGAGGTGGAGGG - Intronic
953528662 3:43717341-43717363 CTTATTTAAACTGATGTAGAAGG - Intronic
957171554 3:76743803-76743825 ATTAATTAAAATGAGGGAGAGGG + Intronic
957195791 3:77065845-77065867 CCTAAGTAAATTGAGATGAATGG + Intronic
957515479 3:81245323-81245345 TTTGTTTAAATTAAGGTGGATGG + Intergenic
958594819 3:96209152-96209174 CATAATTATACTGAGGTTGAAGG + Intergenic
959132772 3:102378232-102378254 CTTAATTTAATTTAATTGGAAGG + Intronic
959439135 3:106355205-106355227 CTCCAAAAAATTGAGGTGGAGGG - Intergenic
959686891 3:109157351-109157373 CTTCATGAGATGGAGGTGGAGGG - Intergenic
959753709 3:109870470-109870492 CTGAGTTAAAAAGAGGTGGAGGG + Intergenic
959766507 3:110036676-110036698 TTTAATTAAACTGATTTGGAAGG + Intergenic
960289716 3:115868669-115868691 CATATTTAAAATGAGGTTGAAGG + Intronic
960458581 3:117904037-117904059 CCTATTTAAATTGAGATGGGGGG + Intergenic
960551667 3:118982662-118982684 CTTAATGATATTAAGGAGGAGGG - Intronic
961690175 3:128663794-128663816 CTTAATTAAATTAAACTGCAGGG + Intronic
962457090 3:135574524-135574546 CTTAATTAAATTGAATTGAATGG + Intergenic
962911238 3:139852391-139852413 TTCAAATAAATTGAGGAGGAGGG - Intergenic
964383235 3:156119618-156119640 CTTAAGTTGATTGAGGGGGAGGG + Intronic
964436980 3:156663847-156663869 CTTAATTCAATCCAGTTGGAAGG + Intergenic
964893325 3:161562847-161562869 GTTAATAAAATGAAGGTGGATGG - Intergenic
967232980 3:187358297-187358319 CTTACATAAATGGAGGTGAAGGG + Intergenic
967622731 3:191652322-191652344 CTTATTTAAATTCAAGTGAAAGG + Intergenic
967761326 3:193229058-193229080 CTTCAATAGATTGAGGTGGGAGG - Intergenic
970981374 4:22102375-22102397 CTTAATTAAATGGATGTGGCTGG + Intergenic
972109350 4:35537348-35537370 CTGAATTAAAGTGAGGAGGAAGG - Intergenic
973328788 4:48891274-48891296 CTTAACTCAGTTGAGGTGGAGGG - Intronic
974529248 4:63085804-63085826 CTTAATCAAATTGAAGTGGCAGG - Intergenic
975793246 4:77978367-77978389 CTTAAAAAAATTGAAGAGGAAGG + Intergenic
977223987 4:94372949-94372971 CTTAGTTCAATTAAGGTAGAGGG - Intergenic
977332555 4:95655912-95655934 TTCCATAAAATTGAGGTGGAGGG - Intergenic
977790792 4:101100127-101100149 TTTAATTAAATTGAAGTTCAGGG - Intronic
978018545 4:103779349-103779371 ATTAATTTAATGGAGGTGGAGGG - Intergenic
978141176 4:105318902-105318924 ATCAATTAAATGTAGGTGGAAGG - Intergenic
978393257 4:108250187-108250209 CTTAATAAAGTTGAGGAGGGGGG + Intergenic
979083356 4:116372434-116372456 CTGCATTAAATTGAGGCTGAGGG + Intergenic
981241662 4:142483856-142483878 ATTAATTAGAAAGAGGTGGATGG + Intronic
981275654 4:142895976-142895998 CTTCAAAAAATTGAGGAGGAGGG - Intergenic
984271014 4:177548673-177548695 CTGAATTGAATTGAATTGGAGGG + Intergenic
985264456 4:188145062-188145084 TTCAATGAAATTGAGGAGGAAGG + Intronic
987548754 5:19350354-19350376 CTTAATTAAATAGTGATAGATGG + Intergenic
988047409 5:25973903-25973925 CATAAGTAAAGTGAGGTGGAGGG - Intergenic
989215983 5:38905086-38905108 CTTTATGACATTGAGTTGGAGGG - Intronic
990733447 5:58834331-58834353 CTTCATTAAAGTGAAGTGGCTGG - Intronic
991284713 5:64959642-64959664 CCTAATTAAGTTGAGGTATAAGG - Intronic
992123015 5:73613949-73613971 CATAATTATATTGAGGCAGAAGG + Intergenic
993417300 5:87651003-87651025 CTTACATATATTGAGTTGGAGGG + Intergenic
994516374 5:100777261-100777283 CTTAATTAAAATAAATTGGAAGG + Intergenic
995977963 5:118064483-118064505 CAAAAAAAAATTGAGGTGGAAGG - Intergenic
996132717 5:119801399-119801421 TTTAGCTAAATTGTGGTGGAGGG - Intergenic
996379318 5:122847347-122847369 GTGAATTAAACTGATGTGGAAGG + Intronic
998200907 5:140119482-140119504 CTGAATTAAATTTGGGTGGAAGG + Exonic
998735836 5:145139418-145139440 CTTAAGAAAATTGATGAGGAGGG - Intergenic
998902759 5:146873596-146873618 AATAACTAAATTGAGGTGGTGGG - Intronic
998999034 5:147899481-147899503 CTCAGTCAAATTGAGGTAGATGG + Intronic
1000229320 5:159300125-159300147 CTTAATTTAATTGGTGGGGAAGG + Intergenic
1000444593 5:161304313-161304335 CTATATTAAATGGAAGTGGAAGG - Intronic
1000805055 5:165779941-165779963 CTTAATCAAATTTAGGTATATGG - Intergenic
1002303372 5:178269851-178269873 AATAAGTAATTTGAGGTGGATGG - Intronic
1002326087 5:178407292-178407314 CTTCATTACTTTCAGGTGGAGGG - Intronic
1008247796 6:49200398-49200420 CTTACATAAATAGAGGTGGATGG - Intergenic
1010903720 6:81459199-81459221 CTAAAATAAAGGGAGGTGGAAGG + Intergenic
1011009275 6:82685628-82685650 GTTGATTAAAATTAGGTGGAGGG + Intergenic
1014802847 6:125796338-125796360 CTGATTTATATTGAGGTGGGTGG - Intronic
1015025340 6:128525618-128525640 GTGAATTGGATTGAGGTGGAGGG + Intergenic
1016441683 6:144090637-144090659 CTCAATTAAATTTATTTGGACGG + Intergenic
1018559375 6:165085657-165085679 CTAAAAAAAATTGAGGTGGGTGG - Intergenic
1022545388 7:31183121-31183143 CTTCAAAAAATTGAGGAGGAGGG - Intergenic
1028389598 7:90299989-90300011 TTTAATTAAATTGTGGAGAAAGG + Exonic
1031536486 7:122940023-122940045 TTTCATAAAATTGAGGAGGAGGG - Intergenic
1032467829 7:132157669-132157691 CTTAATGCAATTCAGGTGGGAGG - Intronic
1036465793 8:8995743-8995765 TTAAATTAAAATGAGGTGGCCGG + Intergenic
1038006340 8:23433524-23433546 CTCAATTAAATGGAGGGGGTGGG + Intronic
1038468832 8:27793288-27793310 CTTAATAAAGCTGAGGGGGAAGG - Intronic
1041398852 8:57419893-57419915 CTTGATTTAATTGAGGTTCAAGG - Intergenic
1043863858 8:85353296-85353318 CTTAATTTAATTTTGTTGGACGG + Intronic
1043944094 8:86230426-86230448 ATTAACAAAATAGAGGTGGAAGG + Intronic
1044258006 8:90088608-90088630 CTTAAAAAAAATGAGGTGGGGGG - Intronic
1045140831 8:99280330-99280352 CTTAATTAAATTGAGTGGCTTGG - Intronic
1046350577 8:113005634-113005656 CATAATGAAAATGAGGAGGATGG - Intronic
1049076042 8:140396787-140396809 CTTAGTTTAATGGAGGTGGAGGG - Intronic
1050085861 9:1965083-1965105 CTTAATGAAAGTAAGGTGCAGGG + Intergenic
1050915426 9:11124544-11124566 CTTAAGTAAAGTGAGCTGAAGGG - Intergenic
1052472923 9:28922933-28922955 CTTTATAAAAGGGAGGTGGAAGG + Intergenic
1056205604 9:84316600-84316622 CCCAATAAAGTTGAGGTGGATGG - Intronic
1057831742 9:98412490-98412512 CTTAAGTTAATGGAGGTTGAAGG + Intronic
1058403794 9:104648010-104648032 CTTCATTAAATAGAGCTAGAGGG + Intergenic
1059159606 9:112021535-112021557 CTTGATAAAACTGAGGTGTAGGG - Intergenic
1188969034 X:36590349-36590371 CTATATAGAATTGAGGTGGAAGG - Intergenic
1190828652 X:54041707-54041729 CTTAATTCAATTTAGTTGGATGG + Intronic
1191929621 X:66356382-66356404 TTCAAAAAAATTGAGGTGGAGGG + Intergenic
1192204160 X:69085229-69085251 CTGAAGAAAATTGGGGTGGAAGG + Intergenic
1192368808 X:70496887-70496909 CTGAATCAAATTGACCTGGATGG - Intronic
1193332095 X:80246126-80246148 CTTTATTAAACTCAGTTGGAGGG + Intergenic
1193833858 X:86319262-86319284 TTAAATTAAATTAAAGTGGAAGG - Intronic
1193855224 X:86592184-86592206 CTTAATTAAATTGTTGTAAATGG + Intronic
1194550892 X:95297680-95297702 TTTAATAAAATTGATGAGGAGGG + Intergenic
1196184132 X:112727148-112727170 TTTAATTAAATGGATGTGGTGGG + Intergenic
1197422066 X:126249818-126249840 TTTAATCAACTTGAGCTGGAGGG + Intergenic
1198261232 X:134966501-134966523 TTTATTTACATTTAGGTGGAGGG - Intergenic
1199295296 X:146150650-146150672 CTTAAGTAAATTGAAGATGAAGG + Intergenic
1200860331 Y:7984382-7984404 CTTAATTAAAATAATGTGAAGGG - Intergenic