ID: 1113874614

View in Genome Browser
Species Human (GRCh38)
Location 13:113586189-113586211
Sequence GCGAATCCTGCATTTCTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113874607_1113874614 16 Left 1113874607 13:113586150-113586172 CCTTAATTAAATTGAGGTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 111
Right 1113874614 13:113586189-113586211 GCGAATCCTGCATTTCTTGGGGG 0: 1
1: 0
2: 1
3: 5
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113874614 Original CRISPR GCGAATCCTGCATTTCTTGG GGG Intronic
913288133 1:117246405-117246427 GAGAATCAGGCAGTTCTTGGTGG - Intergenic
913491526 1:119384367-119384389 GAGAATCCTGAACTTCATGGTGG - Intronic
916213127 1:162374354-162374376 GCCATGCCTGGATTTCTTGGTGG + Exonic
918040068 1:180908519-180908541 TGGAAACCTGCATTTCCTGGTGG - Intergenic
921310287 1:213835565-213835587 GCCTCTCCTGCATTTCTTGAGGG - Intergenic
923770909 1:236936834-236936856 GCAAGTCCTGCTTTTCTAGGGGG - Intergenic
1062856656 10:783263-783285 AGGAATCCTGTATTTCCTGGTGG - Intergenic
1062869200 10:884596-884618 GTGAAATGTGCATTTCTTGGTGG - Intronic
1062870941 10:903700-903722 GTGGATCCTGCATTTCTTCAAGG + Intronic
1069071695 10:63996166-63996188 GGGAGCCCTGCATTTCTTTGGGG + Intergenic
1069714924 10:70514550-70514572 CCGACTCCTTCATCTCTTGGGGG - Intronic
1072348581 10:94534543-94534565 GGAAATCATGCATTTCTTGGCGG - Exonic
1077915247 11:6607378-6607400 GGGAATCCTGCTTTGCATGGTGG + Intronic
1078955933 11:16195064-16195086 GCCAATCCTGCAATACTTGGTGG - Intronic
1079523855 11:21361645-21361667 CAGAATCCCACATTTCTTGGAGG + Intronic
1079692929 11:23442239-23442261 GGCAATCCTGCATTTCTAGTAGG - Intergenic
1082187719 11:49204817-49204839 GCGAATCCTGCAATCATTAGAGG + Intronic
1083624139 11:64063448-64063470 GCGAATTGTGCTTTTCTTGAAGG + Intronic
1088794318 11:113254830-113254852 GGGAATCCTGCACTTCTGTGAGG - Intronic
1089490628 11:118881522-118881544 GAGAATCTTGCATTTGCTGGGGG + Intergenic
1090528391 11:127562465-127562487 ACAAATCCAGTATTTCTTGGAGG + Intergenic
1092003650 12:5050988-5051010 GCCAATCCTGCCTTAATTGGAGG - Intergenic
1097353729 12:58577900-58577922 ACAAATCCTGTATTTCATGGGGG + Intronic
1105819876 13:24070758-24070780 GGGAATTCTTCATTACTTGGGGG - Intronic
1109498378 13:63205882-63205904 CTGAATCCTGCTTTTCTTGATGG - Intergenic
1113874614 13:113586189-113586211 GCGAATCCTGCATTTCTTGGGGG + Intronic
1114865444 14:26588012-26588034 TCAAATCCTGCATTTCTTCTAGG - Intronic
1117240836 14:53830674-53830696 TAGAATCCTAAATTTCTTGGAGG - Intergenic
1118251701 14:64168096-64168118 GCAGATCCTGCTTTTTTTGGTGG + Intronic
1121952921 14:98187644-98187666 GAGGATCCTGGATTTCTTGGTGG + Intergenic
1136294903 16:29295981-29296003 TCGCGTCCTGCATTTCTAGGTGG + Intergenic
1139287302 16:65827081-65827103 GGTAATCCTGAATTTGTTGGGGG - Intergenic
1142100797 16:88269992-88270014 TCGCGTCCTGCATTTCTAGGTGG + Intergenic
1145125543 17:20297107-20297129 AGGACTCCTGCATTTCTTAGAGG - Intronic
1146597691 17:34184254-34184276 GCAAGTCCTGCTTTTCTAGGGGG + Intergenic
1164602143 19:29569325-29569347 GCAACTCCTGCTTTTCCTGGGGG + Intergenic
1164807807 19:31130311-31130333 GAGAATGCTGCAATTTTTGGGGG + Intergenic
1168059310 19:53882449-53882471 CAGGATCCTGCCTTTCTTGGGGG - Exonic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
929377246 2:41302887-41302909 GCGAATCCTGTATTTCTGATGGG - Intergenic
929908601 2:46068938-46068960 GGAAATCCTGCATTTCTAAGAGG - Intronic
1169980750 20:11381018-11381040 TGGAGTCCTGTATTTCTTGGAGG - Intergenic
1170069063 20:12344972-12344994 GCAAGTCCTGCTTTTCTAGGGGG - Intergenic
1184826803 22:46957997-46958019 GCATCTCCTGCATTTCTCGGGGG + Intronic
951690879 3:25395561-25395583 CATAATCCTACATTTCTTGGAGG + Intronic
952663653 3:35879065-35879087 GCAAGTCCTGCTTTTCTAGGGGG - Intergenic
953906915 3:46872994-46873016 GAGAAGCCTCCATCTCTTGGGGG - Intronic
954913000 3:54123792-54123814 GAGTATCCTGCTTTTCTTTGTGG - Intronic
959583151 3:108002394-108002416 GTGACTCCAGCATTCCTTGGAGG + Intergenic
963521427 3:146363072-146363094 GCAAGTCCTGCTTTTCTAGGGGG + Intergenic
965713201 3:171577419-171577441 GCAAGTCCTGCTTTTCTAGGGGG + Intergenic
966383423 3:179367459-179367481 AAGATGCCTGCATTTCTTGGTGG + Exonic
967740284 3:192996636-192996658 GCAAGTCCTGCTTTTCTAGGGGG + Intergenic
970087369 4:12364781-12364803 GCAAGTCCTGCTTTTCTAGGGGG + Intergenic
975934105 4:79558732-79558754 GCAAGTCCTGCTTTTCTAGGGGG - Intergenic
976932248 4:90582035-90582057 CCCATTTCTGCATTTCTTGGTGG + Intronic
977041855 4:92027006-92027028 GCAAGTCCTGCTTTTCTAGGGGG + Intergenic
977217308 4:94297736-94297758 GCAAGTCCTGCTTTTCTAGGGGG - Intergenic
979076404 4:116276136-116276158 TATAATCCTGTATTTCTTGGAGG - Intergenic
979895353 4:126149807-126149829 GCAAGTCCTGCTTTTCTAGGGGG - Intergenic
980787254 4:137571749-137571771 TCTAGTCCTGTATTTCTTGGAGG + Intergenic
981040077 4:140214669-140214691 GCAAGTCCTGCTTTTCTAGGGGG + Intergenic
983447853 4:167877227-167877249 GCAAGTCCCGCTTTTCTTGGAGG + Intergenic
988716950 5:33837517-33837539 GAAAATCCTTCATTTCTTGCAGG + Intronic
990431064 5:55736336-55736358 ATGAATCCTGAAATTCTTGGTGG + Intronic
991977637 5:72198813-72198835 GCGGATGCTGCATCTATTGGTGG - Exonic
992333382 5:75740671-75740693 TAGAATCCTGAATTTGTTGGGGG + Intergenic
993850823 5:93006388-93006410 TAGAATCCTCCTTTTCTTGGAGG + Intergenic
996195765 5:120605210-120605232 GATAATCCTGTATTTCTTGGAGG + Intronic
998511540 5:142718381-142718403 GGCAACCCTGCATTTCATGGAGG - Intergenic
999373143 5:151068407-151068429 GCGAATCCTGCATTATCAGGTGG + Intronic
999468807 5:151832627-151832649 CAGAGTCCTGTATTTCTTGGAGG - Intronic
1003430357 6:6032468-6032490 GCAAGTCCTGCTTTTCTAGGGGG - Intergenic
1007459830 6:42009989-42010011 GCTTAGCCTGCATTCCTTGGAGG - Intronic
1009957380 6:70471968-70471990 GGGAAGCCTTCATTTCTTGAAGG - Intronic
1012421793 6:99073575-99073597 GCAAATCCTGGCTTCCTTGGTGG + Intergenic
1013627023 6:111948803-111948825 TCAAATCCTGGTTTTCTTGGGGG + Intergenic
1015500914 6:133932172-133932194 CGTAATCCTGTATTTCTTGGAGG - Intergenic
1017686460 6:156918317-156918339 GCCAATCCTGCAGATTTTGGGGG + Intronic
1018884944 6:167927462-167927484 CTAAATCCTGCATTTCTTTGTGG - Intronic
1020768869 7:12361728-12361750 ATGAATCATGCATTTCTTGGCGG + Intronic
1021978047 7:26028707-26028729 GCAAGTCCTGCTTTTCTAGGGGG - Intergenic
1022350833 7:29565070-29565092 GCGAATCCTGCCGTTGCTGGTGG + Intronic
1022469514 7:30673721-30673743 CAGCATCCTGCATTGCTTGGAGG + Intronic
1031224665 7:119020971-119020993 GAGAATCCTGCAGTCCTTAGAGG + Intergenic
1036509150 8:9384394-9384416 ACGAATTCAGAATTTCTTGGAGG + Intergenic
1040666116 8:49635513-49635535 AAGGATCCTGCATATCTTGGGGG + Intergenic
1041645370 8:60246265-60246287 ACGAATAATGCATTTCTGGGGGG + Intronic
1041837445 8:62232481-62232503 GCTAATCCTGCACCTGTTGGAGG - Intergenic
1042711462 8:71721981-71722003 GCAAGTTCTGCATTTCTTAGTGG - Intergenic
1050478142 9:6062313-6062335 CATAGTCCTGCATTTCTTGGAGG + Intergenic
1050895893 9:10885835-10885857 GCAAGTACTGCTTTTCTTGGGGG + Intergenic
1051434180 9:17013287-17013309 GGGAATTCAGCATTTCTTTGGGG + Intergenic
1055232854 9:74086664-74086686 GCAAGTCCTGCTTTTCTAGGGGG + Intergenic
1056769399 9:89465974-89465996 GTGACTCCTGCATTTCTTGGAGG + Intronic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1058017016 9:100044940-100044962 GCGAATTCTCCATTTCTATGGGG + Intronic
1061805082 9:133133333-133133355 GGGACTCCTGCATTTCTGCGTGG - Intronic
1187253694 X:17622484-17622506 GGGACTCCTGCTTTTGTTGGAGG - Intronic
1188122234 X:26321790-26321812 GCTACTCCTGCTTTTTTTGGGGG - Intergenic
1188558926 X:31445430-31445452 GCCAATCCAGAATTTCTTAGGGG - Intronic
1189905691 X:45756927-45756949 GCAAAATCAGCATTTCTTGGGGG - Intergenic
1193052153 X:77112843-77112865 CATAATCCTGTATTTCTTGGAGG - Intergenic
1193347220 X:80417971-80417993 CATAATCCTGTATTTCTTGGAGG + Intronic
1194436432 X:93873526-93873548 GCCCATCAGGCATTTCTTGGGGG + Intergenic
1197352252 X:125393523-125393545 GCAAGTCCTGCTTTTCTAGGGGG - Intergenic
1202076751 Y:21044144-21044166 GCAAGTCCTGCTTTTCTAGGGGG - Intergenic