ID: 1113875014

View in Genome Browser
Species Human (GRCh38)
Location 13:113588799-113588821
Sequence TCGGGGACAGTGAGTGGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 240}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113875014 Original CRISPR TCGGGGACAGTGAGTGGTGA TGG Intronic
900482719 1:2907021-2907043 TCGGGGACAGTGAGCCCTGAAGG + Intergenic
900749164 1:4383367-4383389 TCAGGGACAGTGGGAGGTGGGGG + Intergenic
900895770 1:5481942-5481964 CTGGGGACGGTGAGTTGTGAGGG - Intergenic
902889253 1:19429916-19429938 GCAGGGACAGTGAGAGCTGAAGG + Intronic
903082190 1:20819864-20819886 TCAGGGAGAGGGAGTGGAGAAGG + Intronic
903214260 1:21834632-21834654 TGGGGGACAGTGAGTGGGGCAGG - Intronic
904293982 1:29505871-29505893 AGGGACACAGTGAGTGGTGAAGG - Intergenic
904359332 1:29961783-29961805 CCTGGGGCAGTGTGTGGTGAGGG - Intergenic
905706819 1:40066545-40066567 TTAGGGACAGTGATTGGTGCTGG + Intronic
906690928 1:47792384-47792406 TTGTGGTCAGTGAGTGGTGCTGG - Intronic
907364503 1:53946965-53946987 TTGGGGATAGTGAGGCGTGAAGG + Intronic
907589141 1:55649286-55649308 CCGGGGACTGTGTGTGGGGAGGG - Intergenic
909212825 1:72845933-72845955 TAGTGGATAGTGAGTGGTAAAGG - Intergenic
910675888 1:89816149-89816171 TGGGCTACAGAGAGTGGTGATGG + Intronic
910982453 1:92972666-92972688 TCTGGGACTGTGAATGATGATGG + Intergenic
912429926 1:109623703-109623725 TAGGGGACAGTGAGTGGGCAGGG - Intronic
912508872 1:110174952-110174974 TCGGGGAAGGTGAGTGCTGAGGG + Exonic
913188373 1:116391233-116391255 TAGTGGACAGTGAGAGCTGAGGG + Intronic
915312010 1:155009638-155009660 TTGGGGAGAATGAGTGGTGGAGG - Intronic
916759008 1:167800142-167800164 TCAGGGATAGTGGGTGGTGGGGG + Intergenic
917808333 1:178634377-178634399 TGGGGGACTGTGGGTGGGGAGGG - Intergenic
920093615 1:203471650-203471672 TGGGGGAAAGTGAGTGATGAGGG + Intergenic
920631138 1:207653454-207653476 TAGGGGACACTCAGTTGTGAAGG - Intronic
920641667 1:207757910-207757932 TAGGGGACACTCAGTTGTGAAGG - Intronic
921863957 1:220068991-220069013 TAGGGGAGAGTGAATGGGGAGGG + Intronic
923123002 1:231011015-231011037 TGGCGTACAGTGAGTGATGATGG + Intergenic
1062884519 10:1006092-1006114 CCGTGGACAGTGGGTTGTGAGGG + Intronic
1064146984 10:12833486-12833508 TGGGGGAGAGGGAGAGGTGAGGG - Exonic
1065227165 10:23556087-23556109 TGGGGGGCAGGGAGTGGTGGGGG + Intergenic
1065447644 10:25819815-25819837 TCGGGGACAAAGAGTGGGAAGGG - Intergenic
1068574557 10:58670561-58670583 TCAGGGACAGGCAGTGGTCAAGG + Intronic
1069909411 10:71750460-71750482 TCTGGGAAGGTGAGTGGAGAGGG - Exonic
1073284436 10:102379203-102379225 TTAGGGACAGTGAGTGGGGAGGG + Intronic
1073644958 10:105292424-105292446 TCGGGCATAGTGTGTGCTGATGG - Intergenic
1075013192 10:118892094-118892116 TCGGGGACAGGGGGAGGTGATGG + Intergenic
1075450934 10:122551576-122551598 TGGGGCACGGTGAGTTGTGAAGG + Intergenic
1081551802 11:44120488-44120510 TCGGGGGCAGGGAGGGGTGGTGG - Intronic
1081679987 11:44995353-44995375 TCTGAGACAGTAATTGGTGATGG - Intergenic
1083857162 11:65398904-65398926 TCTGGCTCAGTGGGTGGTGAGGG + Intronic
1085077142 11:73601249-73601271 TTGGGGAAAGTGAGTCCTGAGGG - Intergenic
1086277240 11:85146175-85146197 TTGGGGAAAGTGAGAAGTGAGGG - Intronic
1087111820 11:94478037-94478059 TGGGGGACAGGGAGGGGTGCAGG + Intronic
1088863283 11:113821882-113821904 ATGGGGACAGTGGGTGGTGGAGG + Intronic
1089146937 11:116336045-116336067 AAGGGGACAGAGACTGGTGAGGG + Intergenic
1091695260 12:2624030-2624052 TCAGGGCCAGTGAGAGGTGCTGG + Intronic
1091721619 12:2818112-2818134 TTGGTGGCAGTGAGTGCTGAAGG + Exonic
1092314515 12:7396313-7396335 TGGGGCACAGTGTGTGATGACGG - Exonic
1092317509 12:7433592-7433614 TGGGGGACTGTGTGTGATGATGG - Exonic
1100404591 12:94262543-94262565 TCGAGCACTCTGAGTGGTGAGGG + Intronic
1102182266 12:110921524-110921546 GGGGAGACAGTCAGTGGTGAGGG - Intergenic
1103918963 12:124389648-124389670 TCGGGGACTGTGGGTGGGCAGGG + Intronic
1104580320 12:130006766-130006788 TCTGGGAGAGTGGGTGGGGAAGG - Intergenic
1104768494 12:131345811-131345833 ACGGGTACAGTGAGTGCAGAGGG - Intergenic
1104984986 12:132591719-132591741 TCAGGGGCTGTGAGTGGGGACGG - Intergenic
1108460545 13:50662882-50662904 TTGGTGGCAGTGAGTGGAGAAGG - Intronic
1108534412 13:51358905-51358927 TCTGGGACAGAGAATGGTGTGGG + Intronic
1110747227 13:79068525-79068547 TAGGGGGCAGTGAGAGGTCAGGG + Intergenic
1112438129 13:99406101-99406123 TGGGGGACAGCGACTGGGGAGGG + Intergenic
1113779356 13:112967192-112967214 TGGGGGATGGGGAGTGGTGAAGG + Intronic
1113788624 13:113015874-113015896 TCGGGGACCAGGCGTGGTGATGG + Intronic
1113875006 13:113588746-113588768 TGGTGGAGAGTGAGTGGTGATGG + Intronic
1113875014 13:113588799-113588821 TCGGGGACAGTGAGTGGTGATGG + Intronic
1113875025 13:113588854-113588876 TGGGGGAGAGAGAGTGGTGATGG + Intronic
1113875030 13:113588883-113588905 AGGTGGAGAGTGAGTGGTGATGG + Intronic
1113875043 13:113588970-113588992 GGGTGGACAGTGAGTGGTGATGG + Intronic
1114214112 14:20642877-20642899 TCGGGCACAGAGGGAGGTGAGGG + Intergenic
1114526929 14:23372287-23372309 TGGGGGGCAGTGACTGGCGAGGG + Intergenic
1115138950 14:30145710-30145732 TCGGGGCCTGTGAGGGATGAGGG - Intronic
1115528748 14:34306319-34306341 TTGCAGACAGTGAGTGGTGATGG + Intronic
1118215948 14:63808614-63808636 TCAGGGACAGTGTATGGGGATGG + Intergenic
1118231383 14:63953676-63953698 CTGGTGACAGAGAGTGGTGATGG - Intronic
1118626502 14:67664220-67664242 TGGAGAACAGTTAGTGGTGATGG - Intronic
1119642614 14:76326556-76326578 TCATGGACAGTGAGTGTTGCTGG + Intronic
1122914766 14:104853710-104853732 CAGGGGACAGTGTGTGGGGAAGG - Intergenic
1122916585 14:104861915-104861937 GTGGGGACAGAGGGTGGTGATGG - Intergenic
1124210811 15:27763773-27763795 TGGGTGGGAGTGAGTGGTGAGGG + Intronic
1126476912 15:49074926-49074948 TCGGGGCCTGTGGGAGGTGAGGG + Intergenic
1126649656 15:50908320-50908342 CCGGGGACAGTGAGAGGCGGCGG + Intergenic
1127994024 15:64142014-64142036 GTGGGGGCAGTGAGTGCTGAAGG + Intronic
1128144339 15:65324214-65324236 TGGGGGACAGTGAGGTTTGACGG + Intergenic
1128222943 15:65981801-65981823 TTTGGGACAGAGAGAGGTGAGGG - Intronic
1129877182 15:78983378-78983400 TCAAGGACAGTCAGTGGTCAGGG - Intronic
1131032692 15:89199822-89199844 TCGGGGGCAGTGAGGGGTGGGGG - Exonic
1132941450 16:2510433-2510455 ACGGTGAGAGTGAGGGGTGACGG + Intronic
1133441629 16:5825648-5825670 TCTGGGGCAGACAGTGGTGATGG - Intergenic
1135928566 16:26717179-26717201 GAGGGGACAGAGAGTGGGGAAGG - Intergenic
1136484992 16:30565908-30565930 TAGGGGACAGGGAGTGGGGAAGG - Intergenic
1138447015 16:57070819-57070841 ATGGGGTGAGTGAGTGGTGATGG + Intronic
1138447033 16:57070889-57070911 AGGGGGTGAGTGAGTGGTGATGG + Intronic
1138447063 16:57071035-57071057 AGGGGGTGAGTGAGTGGTGATGG + Intronic
1141397027 16:83714072-83714094 TCTGGGGCAGTGAGTGGAGGGGG + Intronic
1141645212 16:85363770-85363792 TCTGGGACAGTGGGTGGGGCGGG + Intergenic
1142159020 16:88547441-88547463 GCGGGGACAGAGGGTGGGGAAGG + Intergenic
1142159029 16:88547465-88547487 GCGGGGACAGAGGGTGGGGAAGG + Intergenic
1142159045 16:88547513-88547535 GCGGGGACAGAGGGTGGGGAAGG + Intergenic
1144750822 17:17647055-17647077 TCGGGGACTGTGAGGGGGAAGGG + Intergenic
1144750841 17:17647106-17647128 TCGGGGACTGTGAGGGGGAAGGG + Intergenic
1146687251 17:34849355-34849377 TTGGGGACAGCGTGTAGTGAGGG - Intergenic
1148875014 17:50681905-50681927 TCCCAGACAGTGAGGGGTGAGGG - Intronic
1151560391 17:74866636-74866658 CTGGGGACACAGAGTGGTGAGGG - Intronic
1152542308 17:80982421-80982443 TGAGGGACAGAGAGTGGGGAGGG + Intergenic
1154316670 18:13309738-13309760 TGAGGGACAGTGAGGGGTGAAGG + Intronic
1156576253 18:38319317-38319339 TCTGGGGCTGTGAGTGCTGAGGG + Intergenic
1157107833 18:44791555-44791577 TCAGGGAAAGTGAGTGGTTTGGG - Intronic
1157171432 18:45410001-45410023 TGGGGGGCAGCGGGTGGTGATGG + Intronic
1157639107 18:49194950-49194972 TTTGGGGGAGTGAGTGGTGATGG + Intronic
1158878135 18:61752260-61752282 TTGGGGACAGTGGCAGGTGATGG - Intergenic
1160395884 18:78572134-78572156 GCGGGGCCCGTGAGTGGTGGCGG + Intergenic
1160930234 19:1566914-1566936 TCGGGGCCAGAGAGTGGAGCAGG + Intronic
1161189227 19:2944104-2944126 TCGGGGAGAGTGGGAGGAGAGGG - Intronic
1161927598 19:7312846-7312868 TTGTGGAAAGTGAGTGGGGATGG - Intergenic
1162818751 19:13210520-13210542 CCGGGGACGGTGAGAGATGACGG + Intronic
1165132551 19:33641736-33641758 TCGGGGGCGGTGTGTGGGGAGGG + Intronic
1165937401 19:39397702-39397724 TGGGGGACAGGGAGTGGGGCAGG + Exonic
1166802986 19:45469455-45469477 CCGGGGACAGAGAGGGGGGAAGG - Intronic
1167832919 19:52041316-52041338 TCTTGGACACTGAGGGGTGACGG + Intronic
925397260 2:3543941-3543963 TCAAGGAAGGTGAGTGGTGAAGG - Intronic
926117591 2:10223343-10223365 AGGGTGACAGTGAGTAGTGAGGG + Intergenic
926432992 2:12808693-12808715 TGTGGGACAGTGAGTGATGCAGG - Intergenic
927012998 2:18925874-18925896 TCGGGGAAAGTGTGGTGTGATGG + Intergenic
930613553 2:53570108-53570130 ACGGGGACATTTAGTGCTGATGG - Intronic
930697996 2:54431110-54431132 TCTGGGTCAGAGAGTGGTGCTGG - Intergenic
932304310 2:70691008-70691030 TGGGGGCCAGTGAGGGGTGAGGG + Intronic
932347285 2:71004002-71004024 TCTGGGGCAGTGGGTGGTGGCGG + Intergenic
934473878 2:94579900-94579922 TCAGGGGAAGTGAGGGGTGATGG - Intergenic
935028704 2:99302003-99302025 TGGGGCACAGGGTGTGGTGAGGG - Intronic
935029281 2:99306505-99306527 TGGGGCACAGGGTGTGGTGAGGG + Intronic
935205347 2:100892044-100892066 TGGGTGACAGTGTGTGGTCAGGG - Intronic
938520262 2:132063028-132063050 TCGGGGACTGTTGGTGGTGGGGG - Intergenic
941005707 2:160244941-160244963 CAGGGGACAGGGAGTTGTGATGG + Intronic
942223942 2:173798424-173798446 TGGGTGACAGACAGTGGTGATGG - Intergenic
943354150 2:186831114-186831136 TGGGGGACAGGGAGTTGAGAAGG - Intronic
944663449 2:201939941-201939963 GAGGGGAGGGTGAGTGGTGACGG + Intergenic
946406629 2:219495461-219495483 TCGAGGGGAGTGAGTGGGGATGG + Intronic
946859582 2:223988063-223988085 TCGGGGACAGTAGCTGGGGAAGG + Intronic
946918044 2:224546878-224546900 TCGGGGATAGTGTGTGGAAAAGG - Intronic
947293636 2:228605560-228605582 TGTGGGACAGGGACTGGTGAGGG + Intergenic
948831622 2:240601128-240601150 TCGGGGACAGTGGCTCCTGAGGG - Intronic
1168931563 20:1628673-1628695 GCCGGGACAGGGAGGGGTGATGG + Intergenic
1174137767 20:48392629-48392651 CCAGGGACAGAGAATGGTGAGGG - Intergenic
1177444512 21:21175197-21175219 CCGGGGTCAGTGGGTGGGGAAGG + Intronic
1179484675 21:41702284-41702306 TCAGGGATAGTGAGTGCTCATGG - Intergenic
1180335667 22:11574870-11574892 TCGGGGGCAGAGAGGGGTGGTGG - Intergenic
1181163314 22:20970238-20970260 TTGGTGACAGTGAATGCTGAAGG - Intronic
1183740314 22:39665225-39665247 CTGGGCACAGTGAGGGGTGAGGG + Intronic
1183774680 22:39956220-39956242 TAGGCTGCAGTGAGTGGTGATGG - Intronic
1184561903 22:45268529-45268551 TAGGGGAGGGTGAGGGGTGAGGG - Intergenic
952041392 3:29266210-29266232 TAGGAGAGAGTGAGTGGGGATGG + Intergenic
952729695 3:36625897-36625919 TCAGGGACACTCATTGGTGATGG + Intergenic
953230159 3:41057770-41057792 AAGGGGACCGTGAGTGGAGAGGG - Intergenic
953406193 3:42660951-42660973 TCAGGCACAGAGAGTGGTGGGGG - Intronic
953998874 3:47540855-47540877 TCTGGGACTGAGACTGGTGAAGG + Intergenic
954277447 3:49551956-49551978 TCTGGGACAGTGAATGGAAATGG + Intergenic
957036883 3:75301812-75301834 TAGGAGACAGTGTGTGGTGAGGG - Intergenic
960798144 3:121510707-121510729 ACAGTTACAGTGAGTGGTGATGG - Intronic
961080660 3:124024556-124024578 CAGGGGCCAGTGTGTGGTGAGGG - Intergenic
961080671 3:124024615-124024637 TAGGAGACAGTGTGTGGTGAGGG - Intergenic
961341497 3:126225192-126225214 TGGGGGACTGTGTGTGATGATGG - Intergenic
961501768 3:127341203-127341225 TGGGGAACAGTGAGTGGTAGGGG - Intergenic
962291922 3:134144819-134144841 TCTGGGAAAGGGAGTGGAGAGGG + Intronic
968631375 4:1653894-1653916 GTGGGGACAGTGACTGGAGAAGG - Intronic
969275164 4:6129816-6129838 TGGGGGACAGTGACAGGTGATGG - Intronic
970498625 4:16653844-16653866 TCGAGGACAGTGAGTGGATTTGG - Intronic
974957719 4:68663741-68663763 TCGGGGGCAGTGAGGGGTAGTGG - Intronic
975781913 4:77848961-77848983 GCGGTTACAGTGAGTGGAGATGG - Intergenic
976369340 4:84268878-84268900 TAGGGGCAAGTGAGTGGTTAAGG + Intergenic
976872134 4:89807859-89807881 TCGTGGAGAGTGAGGAGTGAAGG + Intronic
985387347 4:189461624-189461646 TGGGGAACAATGAGTGGTAAGGG + Intergenic
990768393 5:59213994-59214016 TGGGGGACAGCCAGTGGAGAAGG - Intronic
992701275 5:79344069-79344091 TCGTGGAGAGAGCGTGGTGAAGG + Intergenic
994053435 5:95388840-95388862 TGGGGGATAGTCAGTGTTGAAGG - Intergenic
998069846 5:139188830-139188852 TCGGGGGCAGTGTCTGATGAGGG - Intronic
998484128 5:142486866-142486888 TCGGGGCCAGTGAGATGGGAGGG + Intergenic
999330631 5:150671642-150671664 TCGGGGACGGTGAGCGTGGAGGG + Exonic
999676902 5:154013482-154013504 TGGGGCACAGTGAGTGGTGGGGG + Intronic
999758340 5:154682167-154682189 AGGGGGACAGAGAGAGGTGAGGG - Intergenic
1000131045 5:158299977-158299999 TTCAGGACAGTGGGTGGTGAGGG + Intergenic
1001907310 5:175483860-175483882 GCGGAGACAGTCAGTGGGGAGGG - Intronic
1002137627 5:177117581-177117603 TAGGGTGCAGTGAGCGGTGATGG + Intergenic
1002606435 5:180385499-180385521 TTGGGGAGAGGGAGTGGAGAGGG + Intergenic
1003909004 6:10726745-10726767 GCACGGACAGTGAGTGGTGTGGG + Intronic
1007412474 6:41673080-41673102 GAGGGGACAGTGGGTGGGGAGGG - Intergenic
1007886173 6:45232841-45232863 TCCAGGGCTGTGAGTGGTGACGG - Intronic
1009412196 6:63378796-63378818 GCGGGGACTGTGAGAGGTGTTGG - Intergenic
1010108925 6:72201879-72201901 TCCTGGACAGGGACTGGTGACGG - Intronic
1015689944 6:135910769-135910791 GCGGGGGCAGGGGGTGGTGAAGG - Intronic
1016404216 6:143713547-143713569 TAGGAGGCAGTGAGAGGTGAGGG + Intronic
1016999779 6:149988685-149988707 TTGGCGGCAGTGGGTGGTGAGGG + Intergenic
1017806727 6:157952892-157952914 GTGGGGACAGTGAGTGGACAAGG - Intergenic
1018074424 6:160198990-160199012 TCAGGGAAAGTGAGAGGGGAAGG - Intronic
1018340287 6:162844371-162844393 TCGGAGTCAGAGAGGGGTGACGG - Intronic
1020185205 7:5953729-5953751 TCGGGGAGAGAGAGAGGGGAGGG - Intronic
1023339006 7:39199539-39199561 GCGGTGACAGTTATTGGTGACGG + Intronic
1023863118 7:44227145-44227167 TGGGGGACAGAGAGAGGTGCAGG + Intronic
1024899257 7:54298985-54299007 ACATGGAGAGTGAGTGGTGAGGG + Intergenic
1026362723 7:69617531-69617553 GAGGGGACAGAGAGTGGGGAGGG + Intronic
1028176143 7:87661390-87661412 TGGGGGGCAGTTAGTGGGGATGG - Intronic
1028486376 7:91362395-91362417 TCGGGGGCAGGGAGTGGGGAGGG + Intergenic
1028874026 7:95800453-95800475 TGGGTGACAGTGAGTGAGGAAGG + Intronic
1029441360 7:100588525-100588547 TCTGTGACACTGTGTGGTGAGGG + Intronic
1031118089 7:117689937-117689959 TAGGGGACAATGGGTGGAGAAGG + Intronic
1032498350 7:132379972-132379994 ACAGGGGCAGTGAGGGGTGACGG - Intronic
1033149210 7:138898558-138898580 GCGGGGACAGTGAGTCATGCAGG - Intronic
1033282394 7:140015516-140015538 TCCTGGGCAGTGAGTGGTAATGG + Intronic
1036669455 8:10771663-10771685 TTGGGGCCAGTGGGTGGTGGTGG - Intronic
1038126927 8:24685114-24685136 TCGGGGACTGTGGGGGGTGGGGG + Intergenic
1039893173 8:41697972-41697994 CCTGGGACAGTGATTGTTGAGGG - Intronic
1042857815 8:73285599-73285621 GCGGGCACAGTGAGTGCTGGTGG - Intergenic
1042871760 8:73406059-73406081 GTGGGGACAGTGAGTGGGAAAGG - Intergenic
1043402949 8:79901798-79901820 TTGGGGACAGTGACTGGAGCCGG - Intergenic
1047406601 8:124590517-124590539 TCGGGGTTACTGAGGGGTGAAGG + Intronic
1049047715 8:140165851-140165873 GTGGGTACAGTGAGGGGTGAGGG - Intronic
1049100911 8:140578377-140578399 TTGTGGACAGAGGGTGGTGATGG - Intronic
1049205476 8:141361621-141361643 GCGGGGGCAGTGAGTAGTGTGGG - Intronic
1049265585 8:141666229-141666251 TGAGGGACTGGGAGTGGTGATGG + Intergenic
1049695298 8:143981324-143981346 GTGACGACAGTGAGTGGTGAAGG + Intronic
1049695303 8:143981364-143981386 GTGACGACAGTGAGTGGTGAAGG + Intronic
1049695308 8:143981404-143981426 GTGACGACAGTGAGTGGTGAAGG + Intronic
1049695314 8:143981444-143981466 GTGACGACAGTGAGTGGTGAAGG + Intronic
1049695320 8:143981484-143981506 GTGACGACAGTGAGTGGTGAAGG + Intronic
1049695326 8:143981521-143981543 GTGACGACAGTGAGTGGTGAAGG + Intronic
1049695331 8:143981561-143981583 GTGACGACAGTGAGTGGTGAAGG + Intronic
1049695337 8:143981601-143981623 GTGACGACAGTGAGTGGTGAAGG + Intronic
1049695342 8:143981641-143981663 GTGACGACAGTGAGTGGTGAAGG + Intronic
1049695348 8:143981681-143981703 GTGACGACAGTGAGTGGTGAAGG + Intronic
1049695354 8:143981721-143981743 GTGACGACAGTGAGTGGTGAAGG + Intronic
1049695359 8:143981761-143981783 GTGACGACAGTGAGTGGTGAAGG + Intronic
1049695365 8:143981801-143981823 GTGACGACAGTGAGTGGTGAAGG + Intronic
1049695371 8:143981841-143981863 GTGACGACAGTGAGTGGTGAAGG + Intronic
1049695377 8:143981881-143981903 GTGACGACAGTGAGTGGTGAAGG + Intronic
1049695387 8:143981936-143981958 GTGATGACAGTGAGTGGTGAGGG + Intronic
1049808192 8:144550838-144550860 CTGGGGACACTGAGGGGTGAAGG + Intronic
1050697765 9:8298176-8298198 TTGGGTACAGTGGGTGGTGCCGG - Intergenic
1053135614 9:35648800-35648822 TGGGAGAGAGTGAGTGGAGATGG + Intergenic
1053684198 9:40506212-40506234 TCAGGGGAAGTGAGGGGTGATGG + Intergenic
1053934168 9:43134498-43134520 TCAGGGGAAGTGAGGGGTGACGG + Intergenic
1054279525 9:63118741-63118763 TCAGGGGAAGTGAGGGGTGATGG - Intergenic
1054297292 9:63341676-63341698 TCAGGGGAAGTGAGGGGTGATGG + Intergenic
1054395312 9:64646184-64646206 TCAGGGGAAGTGAGGGGTGATGG + Intergenic
1054429959 9:65151384-65151406 TCAGGGGAAGTGAGGGGTGATGG + Intergenic
1054500425 9:65870148-65870170 TCAGGGGAAGTGAGGGGTGATGG - Intergenic
1054766159 9:69044404-69044426 TGGGGGACAGTGGATGGGGAGGG - Intronic
1055012551 9:71582740-71582762 TGGGGGAGAGTGAGGGGTGAAGG - Intergenic
1056443403 9:86642025-86642047 AGAGGGACAATGAGTGGTGAAGG - Intergenic
1056745174 9:89295489-89295511 TCGGGCACAGAGGGAGGTGAGGG + Intergenic
1058778436 9:108309149-108309171 TCTGCGACAATGAGTGCTGATGG + Intergenic
1060066721 9:120508586-120508608 TGGGGAACAGTGAGTGGGGCTGG - Intronic
1060158026 9:121333675-121333697 TTGGGTACAGAGAGTGGTGATGG - Intergenic
1060978991 9:127781798-127781820 TTGGGGACAGTGTGGGATGATGG + Intergenic
1062129618 9:134885467-134885489 TCGGGGACAGTCAGAGATGATGG + Intronic
1185620255 X:1449723-1449745 TGGGGGATAGTTACTGGTGATGG - Intronic
1185620315 X:1450018-1450040 TGGGGGATAGTTACTGGTGATGG - Intronic
1185749651 X:2600619-2600641 TCTGGGACAGAGAGAAGTGATGG + Intergenic
1187968256 X:24633986-24634008 GAGGGCGCAGTGAGTGGTGATGG - Intronic
1188989440 X:36799901-36799923 TCAGGAACAGTCAGGGGTGAGGG + Intergenic
1190260096 X:48792080-48792102 TTGGGGACAGGGAGTGATGAAGG - Exonic
1192042534 X:67637978-67638000 CTGGGGCCAGTGAGGGGTGAGGG - Intronic
1192159337 X:68771251-68771273 TAGGGGACAGAGATTGGTGGTGG - Intergenic
1192608912 X:72547977-72547999 TAGGGGACGGGGAATGGTGAAGG - Intronic
1192947914 X:75985672-75985694 TGGGGGACAGTGCATGGAGAGGG - Intergenic
1192981218 X:76344749-76344771 TCTGGGACAGAAAGTGGGGATGG + Intergenic
1193337854 X:80312277-80312299 TCGGGAACAGTGGGAGGTGGAGG + Intergenic
1197487891 X:127075701-127075723 TGGGGGACAATGATTGGTGGAGG + Intergenic
1199838732 X:151621768-151621790 TGGGGGACACTGAGTTGTTAAGG + Intronic
1199982837 X:152930215-152930237 AGGGGGACAGAGAGGGGTGATGG + Intronic