ID: 1113877599

View in Genome Browser
Species Human (GRCh38)
Location 13:113604426-113604448
Sequence ACTCACACCCACACTCCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 433
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 392}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113877599 Original CRISPR ACTCACACCCACACTCCTAA GGG Intronic
900293790 1:1938440-1938462 GCTCACACACACACTCCCACAGG + Intronic
901290755 1:8122480-8122502 ACTAACAACCACATACCTAAAGG + Intergenic
902061171 1:13644519-13644541 ACTCTCACCCCCACCCCTGAAGG + Intergenic
903562151 1:24236261-24236283 ACACACACCCACACCCCACAGGG - Intergenic
904756400 1:32770947-32770969 ACTCCCACCCTCCCTCCCAAGGG + Exonic
906436432 1:45800772-45800794 ACTCACTCTTGCACTCCTAATGG - Intronic
908108422 1:60870959-60870981 ATTAACACCCTCACTCCTTATGG - Intronic
909947843 1:81683650-81683672 ACACACACACACACACATAATGG - Intronic
910437328 1:87218558-87218580 ACACACACACACACCCCTCAGGG + Intergenic
910592894 1:88947139-88947161 ACTGACCCCCACCCTCCTCATGG + Intronic
912911856 1:113769196-113769218 CCTCACCCCCAAACTCCTCAGGG + Intronic
913439850 1:118885721-118885743 ACACACACACACACTCCAGAAGG + Intronic
915044942 1:153004548-153004570 ACACACACACACACTCCCAGTGG + Intergenic
915048703 1:153043271-153043293 ACACACACACACACCCCTCATGG + Intergenic
915138185 1:153748798-153748820 TCCCACACCCACACTCCTAATGG - Intronic
917728779 1:177853716-177853738 ACACACACACACACTCCTGCTGG + Intergenic
917919130 1:179735204-179735226 ATTCAGACCCATACTCCTGAAGG + Intergenic
918923430 1:190746513-190746535 ACACACACACACACTTCTTATGG + Intergenic
919236184 1:194845509-194845531 ACACACACACACACACATAATGG - Intergenic
919824672 1:201494813-201494835 ACACACACGCACACTGCTGAGGG - Intronic
920036935 1:203072183-203072205 CCACACACCCACACTCCTGGAGG - Intronic
920256625 1:204659603-204659625 ACACACACACACACACCTGAAGG - Intronic
920922827 1:210312232-210312254 ACCCACACCCACACTCCTCACGG + Intergenic
921639789 1:217539009-217539031 ACCAACACCCACACCCCAAATGG - Intronic
921966144 1:221092137-221092159 AGTTACACCCTCACTGCTAAAGG - Intergenic
923001769 1:230012001-230012023 ACTCACACCCACCCACCTCGCGG - Intergenic
923928105 1:238659044-238659066 ACTGACAAACACACTCCTTATGG - Intergenic
924354065 1:243151195-243151217 ACTGACACCAACATGCCTAAAGG - Intronic
1063073621 10:2692041-2692063 ACACACACGCACACTACTCAGGG + Intergenic
1063447752 10:6130276-6130298 ACACACACACACACTCCTCCAGG - Intergenic
1063843924 10:10103940-10103962 ACTGAAAGCCACACTCCTAAAGG - Intergenic
1066124500 10:32327077-32327099 ACACACACACACACTCACAATGG + Intronic
1067176992 10:43957115-43957137 ACTCTCACCCAGACCCCTAAAGG + Intergenic
1068071228 10:52198799-52198821 ACACACACTCACACCCCAAAAGG - Intronic
1068271126 10:54726411-54726433 ACACACACACACACCCCTGATGG - Intronic
1068322691 10:55440589-55440611 ACACACACCCAAACTAATAAGGG + Intronic
1068368245 10:56080217-56080239 ACACACACACACACCCCTACAGG + Intergenic
1068502860 10:57862180-57862202 ACACACACACACACACATAAAGG - Intergenic
1068883151 10:62071602-62071624 ACACACACACACACTACTATGGG - Intronic
1071251198 10:83821708-83821730 ACGCACACACACAATCCCAATGG + Intergenic
1073082669 10:100869711-100869733 ACACACACTCACATTCCTAGTGG - Intergenic
1073963533 10:108961725-108961747 ACTCACACACACATTCATATTGG - Intergenic
1075624649 10:123953413-123953435 ACTGACCCCCACACTCTTCATGG - Intergenic
1075960659 10:126564735-126564757 ACTCATCCCCACCCTCCTGAAGG + Intronic
1076097050 10:127740207-127740229 ACCCACACCCACACTCACACAGG + Exonic
1076546348 10:131248258-131248280 ACTCACACCCACACACCCACAGG + Intronic
1076940077 10:133599073-133599095 ACACACACACACACCCCTATTGG + Intergenic
1077190237 11:1252964-1252986 ACTCACACTCGCACTCATAGTGG - Exonic
1077556054 11:3226589-3226611 ACTCACACCCAGACTCAAGAGGG + Intergenic
1078769428 11:14334544-14334566 ACACACACACACACACATAATGG + Intronic
1078986357 11:16603518-16603540 CCTCCCACCCCCACTCCCAAAGG - Intronic
1080018436 11:27532555-27532577 ACACACACACACAATCTTAATGG - Intergenic
1080251724 11:30241144-30241166 ACACACACACACACTCCTCCAGG - Intergenic
1081961254 11:47139285-47139307 ACTCCCACACACACCCCTAGAGG + Intronic
1082117305 11:48341358-48341380 ACTCTAACCCACAATCCTAGAGG + Intergenic
1082663394 11:55943535-55943557 ACTCATACCAACACTCTTACTGG + Intergenic
1083459166 11:62799446-62799468 CCTCACCCCCACAATCCTACAGG - Intronic
1085950969 11:81331024-81331046 ACTGACACACACAATCCTATTGG - Intergenic
1086628208 11:88985190-88985212 TTTCATACCCACAATCCTAAAGG + Intronic
1086637560 11:89107388-89107410 ACTGACTCCCACACTCCACATGG - Intergenic
1087041369 11:93804045-93804067 ACGCACACACACACACATAAAGG + Intronic
1087242444 11:95794561-95794583 ACACACACACACACTAGTAAAGG - Intronic
1087334371 11:96824741-96824763 ACTCAAACCCATACTCCCCAAGG - Intergenic
1088006793 11:104950808-104950830 ACACACACACACACACCCAAAGG + Intronic
1088596405 11:111444174-111444196 ACACACACACACACCCCTCAGGG - Intronic
1090843072 11:130509309-130509331 ACTCACACCCACACCAGCAAAGG - Intergenic
1091479468 12:812297-812319 ACACACACACACACTTTTAAAGG + Intronic
1091989464 12:4943201-4943223 CCTCACAGCCCCACTCCTATGGG + Intergenic
1092068221 12:5610848-5610870 ACACACACACACAACCCTAAGGG + Intronic
1092920648 12:13228777-13228799 ACCCACACCCACACTCACACTGG + Intergenic
1094317520 12:29149534-29149556 CCTCACACCCACCCTCCTCGAGG - Intronic
1094679079 12:32651589-32651611 ACACACACACACACCCCTAATGG + Intergenic
1097323610 12:58251820-58251842 ACACACACACACACCCCTACTGG + Intergenic
1098357416 12:69624648-69624670 ACACACACACACACACGTAAAGG - Intergenic
1098437555 12:70484056-70484078 ACTGAAGCCCTCACTCCTAAGGG - Intergenic
1098698545 12:73591634-73591656 ACACACACACACACACATAAGGG - Intergenic
1099305275 12:80946984-80947006 ATACACACACACACCCCTAAAGG - Intronic
1099708645 12:86191121-86191143 ACACACACACACACCCCTATAGG + Intronic
1100984487 12:100191137-100191159 ACACACACACACACTCCAAGAGG + Intergenic
1101920921 12:108932280-108932302 TCTCACACCCATAATCCTAGCGG - Intronic
1102678701 12:114675625-114675647 ACACACACACACACTCTCAACGG - Intronic
1105971285 13:25431020-25431042 ACACACACACACACACATAATGG + Intronic
1106906520 13:34415266-34415288 ACACACACACACACTCACAATGG - Intergenic
1107560318 13:41551996-41552018 CCCCACACCCAGACTCCTCAGGG + Intergenic
1108904616 13:55452742-55452764 ACACACACACACACACATAAAGG - Intergenic
1109986943 13:69998965-69998987 ACTCTCACCCACACTTCTAGAGG + Intronic
1111363355 13:87207110-87207132 ACCCACACCCTCATTCCTGAGGG + Intergenic
1111578402 13:90189876-90189898 GCCCACACCCACACTCCAATTGG - Intergenic
1112877196 13:104058479-104058501 ACACACACACACACCCCAAAGGG - Intergenic
1113877599 13:113604426-113604448 ACTCACACCCACACTCCTAAGGG + Intronic
1114732939 14:25013490-25013512 ACACACACACACACCCCTAAAGG + Intronic
1115075148 14:29380151-29380173 ACACACACACACACCCCTATGGG + Intergenic
1115144545 14:30211269-30211291 ACTCACACTCACACCCCTACGGG + Intergenic
1115290677 14:31768664-31768686 ACTGAAACCCTCACTCTTAAAGG + Intronic
1117491594 14:56253458-56253480 TCTCAGACCCAAACTCCTTAAGG + Intronic
1118230873 14:63948185-63948207 ACACACACACACACTCCTGCTGG + Intronic
1118563144 14:67108704-67108726 ACACACACACACACCCCTTAGGG - Intronic
1120419987 14:84272534-84272556 ACAAACACCCACACTACTCATGG - Intergenic
1122361375 14:101168544-101168566 ACACACACACACACACCAAAGGG - Intergenic
1122603730 14:102934005-102934027 ACTCTCACCAGCACGCCTAAGGG - Intronic
1124020869 15:25921698-25921720 CCTCCCACCCACCCTCCAAAAGG + Intergenic
1124455881 15:29842467-29842489 ACACACACCCACACTCACACTGG + Intronic
1125385290 15:39130490-39130512 ACTCAGACACTCACTCCTAAGGG - Intergenic
1125839828 15:42789774-42789796 ACTTACACACACACACATAATGG - Intronic
1126568887 15:50128721-50128743 ACTAACTCACACACTCCAAAGGG - Intronic
1127183104 15:56446133-56446155 ACACACACACACACTCTTATGGG - Intronic
1127416436 15:58762145-58762167 ACACACACACACACCCCTCAAGG + Intergenic
1127756048 15:62093188-62093210 TCCCACACCAACCCTCCTAAGGG + Intergenic
1127813489 15:62585167-62585189 ACTTACACCCACATTCCTGTGGG + Intronic
1129149036 15:73675887-73675909 ACCCACACCAACAATCCTACTGG - Intergenic
1129179888 15:73867411-73867433 ACTGACACCCTCAGTCCTAGAGG - Intergenic
1129883140 15:79019973-79019995 ACACACACGCTCACTCCTAAAGG - Intronic
1130243611 15:82221616-82221638 ACTCACACCCACTCTGCTGCAGG + Intronic
1130456858 15:84119665-84119687 ACTCACACCCACTCTGCTGCAGG - Intergenic
1131662950 15:94538257-94538279 ACACACACACACACAACTAAGGG + Intergenic
1132289496 15:100689517-100689539 ACACACACACACACCCCTAATGG + Intergenic
1132404392 15:101533519-101533541 GCTCCCACCCACACCCCTCACGG + Intergenic
1134202650 16:12211549-12211571 ACACACACACACACCCCTATTGG - Intronic
1134763972 16:16739613-16739635 ACACACACACACACTCCTCCTGG - Intergenic
1134852340 16:17490411-17490433 ACACACACACACACTCCCCAGGG + Intergenic
1134982082 16:18619550-18619572 ACACACACACACACTCCTCCTGG + Intergenic
1135224572 16:20644563-20644585 ACACACACACACACACATAATGG + Intronic
1135816876 16:25642738-25642760 TCTCAAACCCACACGCCTCAAGG + Intergenic
1135903141 16:26485286-26485308 ACACACACACACACTCTTACTGG - Intergenic
1137491027 16:48932873-48932895 ACTCACACTCACACTCTCACTGG + Intergenic
1137897425 16:52229077-52229099 ACACACACTCACACTCCCCATGG + Intergenic
1138411377 16:56843075-56843097 ACTGTTACCCACATTCCTAAAGG - Intronic
1138725617 16:59135477-59135499 ACACACACACACACCCCAAATGG + Intergenic
1139494121 16:67303506-67303528 ACTCCCTACCACACTCCTTAGGG - Intronic
1141783349 16:86180301-86180323 ATTCACACACACACACCTACTGG + Intergenic
1142628847 17:1210739-1210761 ACTCACACACAAACTCAAAAGGG + Intronic
1143118953 17:4595634-4595656 CCTCACACCCACATTCCCCAGGG + Intronic
1143520371 17:7441026-7441048 AGTCCCACCCCCACTCCTGAGGG + Intronic
1145376494 17:22354089-22354111 ACACACACACACACACATAAAGG + Intergenic
1145378726 17:22375455-22375477 ACCCCCACCCACAGTCCTACAGG - Intergenic
1145827456 17:27887699-27887721 ACACACACCCTCCCTCCTATAGG - Intronic
1146939724 17:36836127-36836149 CCTCACACACACACTCCTCAGGG - Intergenic
1147422704 17:40330597-40330619 CCTCTCACCCACAGTCCTGAGGG - Intronic
1148654339 17:49272066-49272088 ACACACACACACACCCCTACTGG - Intergenic
1148914194 17:50960708-50960730 ACTCCCACCCACAGACATAAAGG - Intergenic
1149881324 17:60294375-60294397 ACACACACACACACTCCTGCAGG - Intronic
1150489235 17:65562975-65562997 ACACACACACACACACATAAAGG + Intronic
1151637899 17:75365011-75365033 CCTAACACCCAAACTTCTAATGG + Intronic
1155307674 18:24494751-24494773 ACTCACAACCACATCACTAATGG - Intergenic
1155618619 18:27749905-27749927 ACACACACACACACTCACAAAGG + Intergenic
1156041890 18:32832326-32832348 ACACACACACACACTCTTAATGG - Intergenic
1157076528 18:44473391-44473413 ACACACACCCCCACCCCCAACGG + Intergenic
1157077673 18:44483390-44483412 ACTCCCACCCTCACTCCCAGGGG - Intergenic
1157672023 18:49538751-49538773 ACTCAAACCTTCACTCCCAAAGG - Intergenic
1158435165 18:57430318-57430340 ACTTCCACCCAAACTCCTCACGG + Intergenic
1158713323 18:59856217-59856239 ACACACACACACACTCCAAAAGG + Intergenic
1159081088 18:63736994-63737016 ACTCATACCCACACCTCTAATGG + Intergenic
1159306341 18:66647766-66647788 GCTCACAGCCCAACTCCTAAAGG + Intergenic
1159667898 18:71185818-71185840 ACTCACACACACACTCACACTGG - Intergenic
1160274992 18:77423514-77423536 ACACACACACACACCCCTAACGG - Intergenic
1161127502 19:2566595-2566617 CCTCCCACCCCCACTGCTAAAGG + Intronic
1162624969 19:11878078-11878100 AATTACAACCACAATCCTAAAGG + Intronic
1163027718 19:14522718-14522740 ACACACACACACACTCCTACTGG + Intronic
1163085749 19:14978914-14978936 ACACACACACACACTCTTTAGGG + Intronic
1164490818 19:28712678-28712700 ACTCACACCCACACTCAGACTGG - Intergenic
1164699860 19:30277669-30277691 ACCCACACACACACTCATACAGG + Intronic
1164820769 19:31249521-31249543 ACACACACACACTCTCCAAAGGG + Intergenic
1165351809 19:35279706-35279728 ACACACACACACACCCCCAAAGG - Exonic
1168427682 19:56252393-56252415 ACACATACCCACACTCCAAGAGG + Intronic
925124879 2:1446977-1446999 ACACACACACACACCCCTCATGG - Intronic
925768905 2:7263517-7263539 ACACACACACACACACATAATGG + Intergenic
926152611 2:10433163-10433185 ACGCACACACACACACCTAGTGG - Intergenic
926265302 2:11311773-11311795 ACACACACACACACCCCTATAGG + Intronic
926383939 2:12317507-12317529 CCTCACACCCACACTGCTTCTGG - Intergenic
926394349 2:12425968-12425990 ACACACACACACACCCCTAATGG - Intergenic
926439019 2:12868178-12868200 ACACACACACACACCCCTAAAGG + Intergenic
927150237 2:20191406-20191428 GCTCACACCCACAGTGCTCAGGG - Intergenic
928001532 2:27527076-27527098 ACACACACACACACTCCTTTAGG + Intergenic
928037675 2:27840384-27840406 ACACACACACACCCTCCTCATGG + Intronic
929440425 2:41962006-41962028 ACACACACACACATTTCTAAAGG - Intergenic
929446399 2:42004744-42004766 ACACACACACACACACATAATGG - Intergenic
929686772 2:44041850-44041872 ACACACACACACACTCTTCATGG - Intergenic
929902680 2:46019330-46019352 ACGCACACCCACACTCAGATGGG - Intronic
930436377 2:51348697-51348719 ACGCACACACACACACCTCATGG + Intergenic
931369177 2:61646353-61646375 ACACACACACACACACATAATGG + Intergenic
931497183 2:62820704-62820726 ACACACACACACACACCCAATGG - Intronic
932760720 2:74437424-74437446 ACCCTCAGCCACTCTCCTAAAGG + Intronic
933846759 2:86332969-86332991 ACTCACTATCACAGTCCTAAGGG - Intronic
936660444 2:114537127-114537149 ACACACACACACCCTCCTAAAGG - Intronic
937912280 2:127081501-127081523 ACACACACCCACAGTCTGAATGG + Intronic
938060432 2:128250498-128250520 ACTCACAGCCACATTACAAAAGG - Intronic
938807846 2:134823268-134823290 ACACACACACACATTCCTATTGG - Intergenic
939880017 2:147620547-147620569 ACACACACACACACCCCTTATGG - Intergenic
940383864 2:153047587-153047609 ACACACACACACACCCCTGAAGG - Intergenic
940724607 2:157322258-157322280 ACACACACACACACACCTCAAGG + Intronic
941035814 2:160567990-160568012 ACTCACACACACACACAAAAGGG - Intergenic
941772910 2:169362757-169362779 ACTCACACACGCACTCATACAGG + Intergenic
941846880 2:170142290-170142312 GCTCAGACCCACACCCCTAAGGG + Intergenic
941881941 2:170489626-170489648 ACACACACACACACCCCTACTGG - Intronic
941978757 2:171433133-171433155 ACTCACACTCACACTCAGACAGG + Intronic
942223204 2:173791264-173791286 ACACACACACACACTGCAAAAGG - Intergenic
942280003 2:174352229-174352251 ACACACACACACACACCTATGGG + Intronic
942425207 2:175852867-175852889 ACTCACATACACACTGATAAAGG - Intergenic
942625591 2:177896819-177896841 ACACACACACACACTCCAATAGG - Intronic
942888200 2:180954720-180954742 ACACACACACACACACATAAGGG - Intergenic
943488084 2:188514032-188514054 ACACACACACACACTCAGAAGGG - Intronic
943521613 2:188958472-188958494 ACTCACACCTAGATCCCTAAAGG - Intergenic
943647083 2:190417957-190417979 ACACACACACACACCACTAAAGG - Intronic
944388286 2:199189030-199189052 ACACACACACACACACATAAAGG + Intergenic
945731993 2:213550070-213550092 ATACACACCCAAACTCATAAAGG - Intronic
946386261 2:219386223-219386245 ACTGACTGCCACACTCCTCAGGG - Intronic
946904975 2:224407187-224407209 ACACACACACACACACCCAAAGG + Intergenic
947150242 2:227108104-227108126 ACTCACACCCACTGTCCTTTTGG - Intronic
948349419 2:237326236-237326258 ACACACACACACACTCATAAAGG - Intronic
949055216 2:241924419-241924441 ACACACACGCACACACCTCATGG + Intergenic
1169465049 20:5830179-5830201 AGTCACAGCAACACTCATAACGG + Intronic
1169481968 20:5990894-5990916 AATCTCAGCCACACTCCCAAAGG - Intronic
1169802039 20:9520481-9520503 ACTCACATGCACACACCGAAAGG - Intronic
1169927080 20:10794689-10794711 ACACACACACACACTGCAAATGG + Intergenic
1170334865 20:15258329-15258351 ACTCACTCACTCACTCCTGAAGG + Intronic
1170708248 20:18765672-18765694 ACCCCCACCTACACTCCTGAAGG + Intergenic
1171799842 20:29601840-29601862 ACACACACACACACACATAAAGG + Intergenic
1172393179 20:34580429-34580451 ACTCAGAGGCACACTCCTATAGG + Intronic
1172777131 20:37414368-37414390 ACACACACACACACTCCTACAGG - Intergenic
1172879242 20:38187939-38187961 ACACACACACACACCCCTATTGG + Intergenic
1173146708 20:40530773-40530795 ACTCACAGCCCTACTCCTCAAGG + Intergenic
1173908814 20:46648951-46648973 ACACACACACACACACATAAAGG + Intronic
1174379293 20:50146452-50146474 ATTCCCAACCACAATCCTAACGG + Intronic
1175534979 20:59703684-59703706 ACTCACACACACACACCCCAAGG - Intronic
1175543054 20:59760172-59760194 CCTGACACCCACACTCATCATGG - Intronic
1176267581 20:64218634-64218656 ACTCCCACCCACCCTCCTCTAGG - Intronic
1177216515 21:18136602-18136624 ACGCACACACACACTCCCACAGG - Intronic
1179517195 21:41916693-41916715 ACACACACACACACTCCCATTGG + Intronic
1180903572 22:19392614-19392636 ACTCACTCCCTATCTCCTAAGGG + Intronic
1182192354 22:28475333-28475355 ACTCACACCCACACTCATACTGG + Intronic
1182388315 22:29966712-29966734 ACACACACGCACACCCCTACAGG - Intronic
1182972448 22:34590690-34590712 ACTGACTCCCACACCCCCAATGG - Intergenic
1183387264 22:37522038-37522060 ACTCCCACCCACAGTGCTATGGG + Intergenic
1183976492 22:41515422-41515444 ACTGACTCCCACACCCCCAATGG + Exonic
1184250256 22:43256131-43256153 ACACACACGCACACACATAATGG + Intronic
1184475879 22:44721014-44721036 ATTCACACCCGCACTCATCATGG + Intronic
1184541471 22:45128435-45128457 GCCCAAACCCTCACTCCTAAGGG - Intergenic
1184559982 22:45256882-45256904 ACACACACACACACTCCAAGGGG - Intergenic
1184997148 22:48216117-48216139 ACACACACACACACCCCTCATGG + Intergenic
1185164713 22:49254440-49254462 ACACACACACACACACATAAAGG + Intergenic
949339545 3:3014074-3014096 ACACACACACACACCCCTAGGGG + Intronic
949506402 3:4732112-4732134 ACTTTCACCCGCACTCCTAAGGG - Intronic
949973992 3:9437516-9437538 ACACACACACACACACGTAAAGG - Intronic
950335751 3:12191465-12191487 ACACACACACACACCCCTCATGG - Intergenic
951921167 3:27855619-27855641 ACTCAAAACCACACAACTAATGG + Intergenic
952674167 3:36007171-36007193 TCACACACACACACCCCTAAGGG + Intergenic
953532044 3:43747804-43747826 TCTCACACCCTGGCTCCTAAGGG - Intergenic
955373687 3:58375709-58375731 ACACACACCCACACTCACATGGG - Intronic
956736044 3:72239092-72239114 TCTCCCACCCAAACCCCTAAGGG + Intergenic
957138624 3:76323163-76323185 ACACACACACACACCCCTAAAGG + Intronic
958023839 3:88027527-88027549 ACTCAGACCCACATCCCTGAGGG + Intergenic
959365006 3:105446635-105446657 ACACACACACACACACATAATGG + Intronic
959377123 3:105601124-105601146 ACACACACACACACTTATAAAGG + Intergenic
960771761 3:121200776-121200798 ACTCAAAACCACACAACTAATGG - Intronic
960923093 3:122768168-122768190 AGTCACTCCCACACTTCTACAGG + Intronic
961037167 3:123650472-123650494 ACTCACACTCACACTCACACCGG - Intronic
961209533 3:125115040-125115062 ACTCCCTTCCACACTCCTTATGG - Intronic
961533385 3:127554196-127554218 ACACACACACACACTTCAAATGG - Intergenic
962371851 3:134827387-134827409 ACATACACACACACTCCTTATGG + Intronic
963035734 3:141026614-141026636 ACACACACACACACCCCAAATGG - Intergenic
963630567 3:147725107-147725129 ACACAAACCCTCATTCCTAAAGG - Intergenic
964299321 3:155270903-155270925 CCACACAGCCACAGTCCTAAAGG - Intergenic
965812708 3:172608168-172608190 ACACACACACACACCCCTATTGG + Intergenic
966026666 3:175292608-175292630 ACACACACACACACACCTGAGGG + Intronic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
967452107 3:189637091-189637113 ACACACACACACACTCACAATGG + Intronic
967618726 3:191605141-191605163 ACTCAGACCCACACTTTTTAGGG + Intergenic
968187210 3:196640887-196640909 TCTAGCACCCAGACTCCTAACGG - Intronic
969396035 4:6922017-6922039 AATCACACGCACACATCTAAGGG - Intronic
971102627 4:23484598-23484620 ATTCAAACTCACACTCCAAATGG - Intergenic
971841774 4:31861975-31861997 GCTCCCAGCCACACTCCTATTGG - Intergenic
972334255 4:38092876-38092898 ACTCACACACACACTCAGACTGG + Intronic
976297399 4:83485794-83485816 ACACACACACACACACGTAAAGG + Intronic
976879671 4:89904617-89904639 ACACACACGCACACTCAAAATGG - Intronic
977802931 4:101259721-101259743 ACACACACACACCATCCTAAAGG + Intronic
977812382 4:101371784-101371806 ACACACACACACACACCCAATGG - Intergenic
977836026 4:101647326-101647348 ACACACACACACAATCCTCAGGG - Intronic
978671580 4:111253976-111253998 ACACACACACACACACATAATGG + Intergenic
978723989 4:111948338-111948360 ACTCACTTCCATACTACTAAAGG - Intergenic
979036996 4:115733424-115733446 ACTCACACCTACATCCCAAAAGG - Intergenic
980322264 4:131293581-131293603 ACTGACAGCAACACTCCTATGGG + Intergenic
981010591 4:139921219-139921241 ACTCACATCCAGACTCCAAGTGG + Intronic
981623888 4:146735165-146735187 ACTCAAAGCCACCCCCCTAAAGG + Intronic
982548358 4:156763113-156763135 ACACACAGTCACACTCCTCATGG + Exonic
982830238 4:160050419-160050441 ACACACACACACACACATAATGG + Intergenic
982851681 4:160325430-160325452 ACACACACACACACACATAAAGG + Intergenic
982952223 4:161713650-161713672 ACACACACACACACCCCTACAGG + Intronic
983556552 4:169064182-169064204 ACACACACACACACGGCTAAGGG - Intergenic
983864480 4:172748301-172748323 ACACACACCCACACTCAGACTGG + Intronic
984243055 4:177241119-177241141 ACACACACACACACACCTTAAGG - Intergenic
985266545 4:188156754-188156776 CCTCACACCCCCACACCGAAGGG + Intergenic
987105882 5:14638601-14638623 ACACACACACACACTCATCATGG - Intergenic
987884375 5:23794608-23794630 TCTCACAACCACATTACTAAAGG - Intergenic
988024097 5:25662235-25662257 ACTCACACTCACACTCACACAGG + Intergenic
988853263 5:35199955-35199977 ACTCACACCCACACTTTGGAGGG - Intronic
989123617 5:38029618-38029640 ATTCACACACACACACCTACTGG - Intergenic
989641251 5:43585279-43585301 ATTCTCACCCACAATCCTATGGG - Intergenic
989641294 5:43585499-43585521 ACTCTAACCCACAATCCTAGAGG - Intergenic
989998506 5:50864128-50864150 ACACACACACACACTCTCAAGGG + Intergenic
990998354 5:61756488-61756510 ACACACACACACACACCTTAAGG - Intergenic
991374870 5:65956238-65956260 CCACACACCCACACCCCGAAGGG - Intronic
993120363 5:83766672-83766694 AATCTCACCCACAATCCTAGAGG - Intergenic
993740924 5:91538736-91538758 ACACACACACACACTACTATTGG + Intergenic
993907584 5:93640547-93640569 ACACACACACACACCCCTATAGG - Intronic
994266643 5:97724076-97724098 ACACACACACACACACCTCACGG + Intergenic
995493431 5:112716651-112716673 ACTCAAATCCACAATCATAATGG - Intronic
995842355 5:116454783-116454805 ACACACACACACACACTTAAAGG - Intronic
996364263 5:122683951-122683973 ACACACACACACACACCTTAAGG + Intergenic
996545107 5:124669673-124669695 ACACACACACACACTCCTGGAGG + Intronic
996547039 5:124690939-124690961 ACACACACACACACACATAATGG + Intronic
996856192 5:128010053-128010075 ACACACACACACACATCTAATGG - Intergenic
996884306 5:128337991-128338013 ACTCACCCACACAGTCCTCACGG + Exonic
997064978 5:130549233-130549255 ACTCCCACCCACACCCCGACTGG + Intergenic
997207044 5:132056263-132056285 ACTCACCCCCACAGGCCTAGTGG - Intergenic
997269547 5:132525381-132525403 ACACACACTCACACTCATAAAGG - Intergenic
999611729 5:153377085-153377107 ACACACACACACACCCCTTACGG - Intergenic
999763090 5:154717877-154717899 ACACACACACACACACCTATGGG + Intronic
1000867615 5:166534463-166534485 ACACACACACACACTGCTAGAGG - Intergenic
1003435058 6:6080533-6080555 ACACACACACACACACCTGATGG + Intergenic
1003549414 6:7089203-7089225 AAACACACACACACTCCTATAGG - Intergenic
1004458748 6:15816392-15816414 ACACACACACACACACATAATGG + Intergenic
1006085552 6:31592634-31592656 CCTCCCACCCACACTCCTTGGGG + Intronic
1007230602 6:40345274-40345296 ACACACACACACAGTCCTCAGGG + Intergenic
1007536803 6:42598562-42598584 ACTCACTCCCACACCCCAAGGGG - Intronic
1008090625 6:47290328-47290350 ACCCACACACACACTCACAAGGG + Intronic
1008798459 6:55336829-55336851 ACACACACACACACTCTTTATGG - Intronic
1010088860 6:71954879-71954901 ACACACACACACACACCTAGAGG + Intronic
1012036333 6:94145636-94145658 ACACACACACACACACATAACGG - Intergenic
1012988926 6:105904862-105904884 ACCCACACCCACACTCACACGGG - Intergenic
1014453750 6:121613417-121613439 ACACACACACACAAACCTAAAGG + Intergenic
1015792153 6:136974357-136974379 ACTCACACCCAGACTCCACGAGG + Intergenic
1016591137 6:145744775-145744797 ACTCACATACTCACTCCTGAAGG - Intergenic
1016772762 6:147870425-147870447 ACACACACACACACACCAAAGGG - Intergenic
1016796492 6:148123533-148123555 ATCCACACACACACTCCTCACGG - Intergenic
1016947106 6:149545658-149545680 CCCCACACACACACTCCCAAAGG + Intronic
1017824269 6:158070160-158070182 ACCCACACCCACACCCCAAGAGG - Intronic
1017844638 6:158246015-158246037 ACACACACACACACCCCTAAGGG - Intronic
1020127068 7:5539024-5539046 ACTCACAACCACTCTCCTAGAGG + Intronic
1020960962 7:14800869-14800891 ACTCACACCTCCATTCCTGAAGG - Intronic
1021381916 7:19978120-19978142 ACACACACACACACACATAAAGG + Intergenic
1021400090 7:20200018-20200040 ACACACACACACACACATAATGG - Intronic
1022141706 7:27498743-27498765 ACACACACCCACACTCACACTGG + Intergenic
1022191224 7:28018347-28018369 AATGAAACCCACACTCCCAACGG - Intronic
1024272000 7:47649688-47649710 ATTCACACCCAAAGTTCTAAAGG - Intergenic
1024636977 7:51299180-51299202 ACACACACACACACTCCTCCAGG + Intronic
1024765770 7:52657303-52657325 ACACACACACACACTCTAAAAGG + Intergenic
1024909804 7:54434034-54434056 ACACACACACACACCCCCAATGG + Intergenic
1025090304 7:56057353-56057375 ACACACACACACACCCCAAAGGG - Intronic
1025292668 7:57744737-57744759 ACACACACACACACACATAAAGG - Intergenic
1026772008 7:73208258-73208280 ACACACACACACACACATAAAGG + Intergenic
1027012877 7:74761654-74761676 ACACACACACACACACATAAAGG + Intergenic
1027075164 7:75184398-75184420 ACACACACACACACACATAAAGG - Intergenic
1027435826 7:78163519-78163541 ACTGACTCCCACATTCCCAATGG - Intronic
1027584156 7:80036127-80036149 ACTCATACCAACACTGGTAATGG + Intergenic
1031320199 7:120315757-120315779 ACACACACACACACTGCTTATGG - Intronic
1031933185 7:127707758-127707780 ACACACACACACACTCCTACTGG - Intronic
1032089669 7:128904976-128904998 ACACACACACACACTCTTCAGGG - Intronic
1032216334 7:129960306-129960328 AGTAACACCCAGACTCTTAAAGG + Intergenic
1032442693 7:131954197-131954219 ACACACACACACACTCCTGCTGG + Intergenic
1033508138 7:142026595-142026617 CCTCCCACCTACTCTCCTAAGGG - Intronic
1033924568 7:146442427-146442449 ACACACACACACACCCCAAATGG - Intronic
1034304142 7:150037265-150037287 ACTAACACCCACAGTCCTCCAGG + Intergenic
1034304260 7:150037654-150037676 ACTAACACCCACAGTCCTCCAGG + Intergenic
1034304629 7:150039083-150039105 ACTAACACCCACAGTCCTCCAGG + Intergenic
1034304802 7:150039630-150039652 ACTAACACCCACAGTCCTCCAGG + Intergenic
1034305378 7:150041991-150042013 ACTAACACCCACAGTCCTCCAGG + Intergenic
1034791795 7:153977190-153977212 ACACACACACACACCCCTATTGG - Intronic
1034802651 7:154062910-154062932 ACTAACACCCACAGTCCTCCAGG - Intronic
1034948671 7:155281554-155281576 CCACACACCCCAACTCCTAATGG - Intergenic
1034948752 7:155282329-155282351 CCACACACCCCAACTCCTAATGG - Intergenic
1035729475 8:1844188-1844210 ACCCACACCCACAGTGCCAAGGG - Intronic
1036117396 8:5972874-5972896 AATGAAATCCACACTCCTAATGG + Intergenic
1036753158 8:11455886-11455908 ACTCACACTCACACTCTGCAAGG - Intronic
1037246972 8:16846103-16846125 ACACACACACACACACCTGAAGG - Intergenic
1037379523 8:18269677-18269699 ACACACACACACACACCTCATGG - Intergenic
1037628664 8:20632000-20632022 AATCACACAGCCACTCCTAATGG - Intergenic
1037895452 8:22649845-22649867 ACACACACACACACCCCCAAAGG + Intronic
1037901205 8:22690651-22690673 ACTCACATCCGCACTCATACGGG - Exonic
1038422681 8:27443374-27443396 TCTCAGACCCACCCACCTAATGG - Intronic
1039041234 8:33410612-33410634 ACACACACGCACACACCCAAAGG - Intronic
1039188211 8:34941252-34941274 ACCCACACTCACCCTCCTGAAGG + Intergenic
1039504524 8:38042347-38042369 ACTCACACACATGCTCCTTAAGG - Intronic
1039789044 8:40859476-40859498 ACACACACACACACCCCTTAAGG + Intronic
1041088398 8:54278926-54278948 ACTCACACTCACACTCATACTGG + Intergenic
1041523001 8:58775444-58775466 ACACACACACACACACATAATGG - Intergenic
1041759184 8:61345613-61345635 ACACACACACACACCCCTAGAGG - Intronic
1042988989 8:74617450-74617472 ACACACACACACACACCCAATGG - Intronic
1043917879 8:85944815-85944837 TCACACACACACACTCCTCAGGG + Intergenic
1045346930 8:101301687-101301709 ACTCACACCCACACACAAGATGG - Intergenic
1047300873 8:123612607-123612629 ACTCTCTCTCACTCTCCTAAGGG - Intergenic
1048002661 8:130392233-130392255 ACTCTCATACACACTCCTAAAGG + Intronic
1048995481 8:139791405-139791427 ACTCACACACACACTCACACAGG + Intronic
1048995497 8:139791508-139791530 ACTCACACACACACTCACACAGG + Intronic
1049149423 8:141024877-141024899 ACACACACACACACACCAAAAGG + Intergenic
1049804715 8:144533653-144533675 ACTCACTCCCACCTTCCCAAGGG - Intronic
1051337376 9:16078086-16078108 ACACACACACACACTCACAAAGG + Intergenic
1051442907 9:17105795-17105817 ACACACACACACACACGTAATGG - Intergenic
1053039800 9:34860679-34860701 ACACACACACACACTTTTAAAGG - Intergenic
1053642986 9:40106176-40106198 ACACACACACACACCCATAACGG + Intergenic
1054541774 9:66270427-66270449 ACACACACACACACCCATAATGG - Intergenic
1054799352 9:69331791-69331813 ACTCACTCACACACCACTAAAGG - Intronic
1056301648 9:85248430-85248452 ACACACACACATACTCCTATGGG - Intergenic
1056573657 9:87837954-87837976 ACACACACACACACTCTTGATGG + Intergenic
1056933336 9:90896626-90896648 ACTCAAATTCACACTCCAAAAGG - Exonic
1057795486 9:98153692-98153714 ACTCACACACACACCCCGAGAGG + Intronic
1057938110 9:99257684-99257706 CTTCTCACCCACACTCCTCATGG - Intergenic
1060963783 9:127700300-127700322 CCTCCCACCCACACCCCTTATGG + Intronic
1061953177 9:133947789-133947811 TCTCACACACACACTCACAAAGG - Intronic
1062562792 9:137149256-137149278 ACCCGCACCCACACTCCTATCGG + Intronic
1185845148 X:3430886-3430908 ACACACACACACACCCCTAATGG + Intergenic
1186483226 X:9912136-9912158 ACACACACACACACACATAAAGG + Intronic
1186483236 X:9912235-9912257 ACACACACACACACACATAAAGG + Intronic
1186747826 X:12587637-12587659 ACACACACACACACTCATAATGG - Intronic
1187022491 X:15398655-15398677 ACACACACCCTCCCTCCTCAAGG - Intronic
1187217905 X:17295028-17295050 ACACACACACACACTCGTGAGGG - Intergenic
1188226210 X:27601265-27601287 ATTCACACCCTCACTCATATAGG + Intronic
1188737132 X:33731161-33731183 ACACACACGCACACTCCTGATGG - Intergenic
1193407014 X:81113404-81113426 ACACACACACACACTCATACTGG + Intergenic
1193750589 X:85338396-85338418 ACACACACTCACACACCAAAAGG - Intronic
1193829522 X:86272191-86272213 ACACACACACACACTCTCAAAGG - Intronic
1194098250 X:89670827-89670849 ACACACACACACACAGCTAAAGG - Intergenic
1194492227 X:94566328-94566350 ACACACACGCACACACATAAAGG - Intergenic
1195006535 X:100690832-100690854 ACTCACACCCTCATTCTTAAGGG + Intronic
1195416002 X:104620084-104620106 ACTTCCAGCCAAACTCCTAATGG - Intronic
1196102071 X:111856871-111856893 ACACACACACACACTTCTTATGG - Intronic
1196478119 X:116112514-116112536 ACTCAAACACACACTCTTACTGG - Intergenic
1197508648 X:127342652-127342674 ACACACACACACACCCCTACAGG + Intergenic
1198182222 X:134220925-134220947 ACCCCCACCCACACACCCAAAGG - Intergenic
1199820691 X:151442670-151442692 ACACACACACACACACATAAAGG - Intergenic
1199972685 X:152872493-152872515 ACACACACCCACACCCCCAGAGG - Intergenic
1200167336 X:154045891-154045913 ACACACACACACACTCCTTCTGG - Intronic
1200451266 Y:3332215-3332237 ACACACACACACACAGCTAAAGG - Intergenic
1200819142 Y:7564195-7564217 ACACACACACACACCCCTAATGG - Intergenic