ID: 1113879097

View in Genome Browser
Species Human (GRCh38)
Location 13:113612942-113612964
Sequence GGAGCTGCTGCCGGCGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113879097_1113879101 1 Left 1113879097 13:113612942-113612964 CCTGGATCGCCGGCAGCAGCTCC 0: 1
1: 0
2: 1
3: 17
4: 199
Right 1113879101 13:113612966-113612988 GGACCTCCCCTGCCCTCACCTGG 0: 1
1: 0
2: 1
3: 53
4: 484
1113879097_1113879110 27 Left 1113879097 13:113612942-113612964 CCTGGATCGCCGGCAGCAGCTCC 0: 1
1: 0
2: 1
3: 17
4: 199
Right 1113879110 13:113612992-113613014 TGATTCCACCGCACAGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 38
1113879097_1113879109 24 Left 1113879097 13:113612942-113612964 CCTGGATCGCCGGCAGCAGCTCC 0: 1
1: 0
2: 1
3: 17
4: 199
Right 1113879109 13:113612989-113613011 TGTTGATTCCACCGCACAGACGG 0: 1
1: 0
2: 0
3: 3
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113879097 Original CRISPR GGAGCTGCTGCCGGCGATCC AGG (reversed) Intronic