ID: 1113879508

View in Genome Browser
Species Human (GRCh38)
Location 13:113615905-113615927
Sequence CTGTCTCAAAATGAGTAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 183}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113879502_1113879508 2 Left 1113879502 13:113615880-113615902 CCAGCCTGAGTGACAGAGCCAGA 0: 131
1: 4561
2: 59488
3: 146241
4: 170325
Right 1113879508 13:113615905-113615927 CTGTCTCAAAATGAGTAGGCTGG 0: 1
1: 0
2: 3
3: 24
4: 183
1113879501_1113879508 12 Left 1113879501 13:113615870-113615892 CCACTGCACTCCAGCCTGAGTGA 0: 4459
1: 91767
2: 180036
3: 206189
4: 175558
Right 1113879508 13:113615905-113615927 CTGTCTCAAAATGAGTAGGCTGG 0: 1
1: 0
2: 3
3: 24
4: 183
1113879503_1113879508 -2 Left 1113879503 13:113615884-113615906 CCTGAGTGACAGAGCCAGACCCT 0: 53
1: 1200
2: 10419
3: 46388
4: 114518
Right 1113879508 13:113615905-113615927 CTGTCTCAAAATGAGTAGGCTGG 0: 1
1: 0
2: 3
3: 24
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113879508 Original CRISPR CTGTCTCAAAATGAGTAGGC TGG Intronic
900773359 1:4563303-4563325 CTGTCTCTAAAAAAATAGGCTGG - Intergenic
902328019 1:15715343-15715365 CTGTCTCAAAACAAACAGGCCGG + Intronic
902986950 1:20160748-20160770 CTTTCTCAAAATGAGGAAGCTGG - Intergenic
903427585 1:23265882-23265904 CTGTCTCAAAAACAACAGGCCGG - Intergenic
903522925 1:23967302-23967324 CTGTCTCAAACTGAATTGGGTGG - Intronic
905411927 1:37776486-37776508 CTGTCTCAAAAAAAAAAGGCCGG - Intergenic
905489101 1:38329592-38329614 CTTTATCAAAATGAGCAGGTTGG - Intergenic
907180371 1:52564474-52564496 ATGTGTCAAAATGAGCAAGCAGG + Intergenic
907354710 1:53862839-53862861 CTGTTTCTAAGTGAGGAGGCAGG + Intronic
909654838 1:78020149-78020171 CTGTCTCAAAAAAAGGAAGCTGG + Intronic
911017920 1:93354604-93354626 CTGTTTCAAAAAGAGAAGGGAGG + Intronic
914718969 1:150273562-150273584 CTTTCTTAAAATGAGTCAGCTGG - Intronic
916629524 1:166596888-166596910 CTGCCTGAAAATGAATGGGCTGG + Intergenic
916777223 1:167979880-167979902 CTGTCTCAAAATAAATAAACAGG + Intronic
920418949 1:205817367-205817389 ATGTCTCAAGATGAGTATTCAGG - Intergenic
920455771 1:206099937-206099959 CTTTCTGAAAAAAAGTAGGCTGG - Intronic
920561606 1:206942714-206942736 ATGTCACAAAATGAGAAGTCTGG - Intronic
922497397 1:226069529-226069551 CCATTTCAAAATGAGTAAGCAGG + Intronic
923660455 1:235952587-235952609 CCGTCTCAAAATAAATAGGTTGG - Intergenic
1069436256 10:68386641-68386663 ATGTAAAAAAATGAGTAGGCCGG - Intronic
1069678142 10:70264076-70264098 CTGTCTCAAAAAAAAGAGGCCGG + Intronic
1071539587 10:86468492-86468514 CTGTATCATAAAGAATAGGCTGG - Intronic
1073537047 10:104287056-104287078 CTGTCTCAAAATAAAATGGCAGG - Intronic
1074152737 10:110772068-110772090 CAGTCTCAAATTGAGGAAGCTGG - Intronic
1074533924 10:114315273-114315295 CTGTCTCACAAAGAGGAGGATGG + Intronic
1075227586 10:120643671-120643693 CTGCCTCAAAATAAGTGGGCTGG - Intergenic
1076680384 10:132168630-132168652 CTGTCTCAGGTTGAGTAGGGAGG - Exonic
1078793040 11:14564112-14564134 CTGTATCAATATCAGTATGCTGG - Intronic
1079564494 11:21864981-21865003 CTGTCTCAAAAAGAGGAGAAGGG - Intergenic
1079827643 11:25217747-25217769 ATGTCTCAAAATTACTAGACTGG - Intergenic
1081977348 11:47244130-47244152 CTGTCTCAAAATAAATAGGCTGG + Intronic
1082045648 11:47724230-47724252 CTGTCTCAAAAAAAGGAGGTGGG - Intronic
1082829292 11:57603540-57603562 CTGTCTCAAAAAAAAAAGGCCGG + Intronic
1083258932 11:61512889-61512911 CTGTCTCCATGTGAGTAGGGAGG + Intergenic
1084346945 11:68559171-68559193 CTGTCTTAAAATGCATGGGCAGG + Intronic
1085054135 11:73394308-73394330 CTGTGTCCAAGTGAGTGGGCTGG + Exonic
1087224475 11:95582516-95582538 CTGTCTTATACTGAGTAGCCTGG - Intergenic
1087727864 11:101742752-101742774 CTGTCTGAAAAAGAGTAAACTGG + Intronic
1089478734 11:118788692-118788714 CTGTCTCAAAAATAATAGGCCGG - Intronic
1090371027 11:126252736-126252758 ATGTCTCTAAATAAATAGGCTGG + Intronic
1091157193 11:133384817-133384839 CTGTCCCAGAATGCCTAGGCTGG + Intronic
1091979104 12:4851172-4851194 CGGTCTCCACAAGAGTAGGCAGG + Intronic
1092564488 12:9649742-9649764 CTGTCTCAGTATTAGTAGGAGGG + Intergenic
1094021634 12:25920864-25920886 CTGTCTCAAAATGTGTACACAGG - Intergenic
1094555360 12:31494245-31494267 CTGTCTCAAAATAGGTAGGTAGG - Intronic
1096708279 12:53436971-53436993 CTGTCTCAAAACAAACAGGCTGG - Intergenic
1097003168 12:55895710-55895732 CTGTCTCAAAAAAAGAAGGCCGG + Intergenic
1098333554 12:69379415-69379437 CTGTCTCAAAATAAAAAGGCAGG - Intronic
1100130963 12:91492856-91492878 CTGTTTCACAATGAGGAAGCAGG - Intergenic
1100287247 12:93178806-93178828 TTGGCTGAAAATGAGTAAGCAGG - Intergenic
1100826171 12:98476648-98476670 CTGTATCAGAATGAATGGGCAGG + Intergenic
1102264923 12:111475207-111475229 CTGTCTCAAAAAAAAAAGGCTGG + Intronic
1102864446 12:116362861-116362883 CTGACTCAAAAACAGAAGGCAGG + Intergenic
1103441219 12:120964416-120964438 CTGTCTCAAAATAAGTACATAGG - Intergenic
1105965751 13:25383049-25383071 CTGTCTCAAAAAGAAAAGGCTGG - Intronic
1106060246 13:26283601-26283623 CCGTCTCAAAAAAAGTAGACTGG + Intronic
1106482136 13:30144514-30144536 GTGTCTCAAAAAGTGCAGGCTGG + Intergenic
1107234243 13:38149661-38149683 GTATCTCAAAATGACTAGACGGG + Intergenic
1108732718 13:53251545-53251567 CTCTCTCAAAAGGAGTGGGGTGG + Intergenic
1110567444 13:76970498-76970520 CTGTCTCAAAAAAAGGAGGTGGG + Intergenic
1112025740 13:95409356-95409378 CTGTCTCAAAATAAAAAGGAGGG - Intergenic
1112581875 13:100683263-100683285 CTGTCTCTAAAAATGTAGGCAGG - Intergenic
1113879508 13:113615905-113615927 CTGTCTCAAAATGAGTAGGCTGG + Intronic
1117841302 14:59863084-59863106 GTGTCTCTGAATGAGTAAGCAGG - Intronic
1118237550 14:64022926-64022948 CTGTATCAAAATAAATAGGGAGG + Intronic
1119282753 14:73423803-73423825 CTGTCTCAAAAAAATTAGCCAGG + Intronic
1120043536 14:79780217-79780239 CTATCTCAAAATGAATAGCAAGG - Intronic
1121830774 14:97050221-97050243 CTGTTCCAAAAGGTGTAGGCTGG - Intergenic
1122219304 14:100225982-100226004 CTGTCTAAAAAAAAATAGGCTGG + Intergenic
1122279651 14:100613927-100613949 CTGTCTCAAAAAGGATAGGCCGG - Intergenic
1124486622 15:30123060-30123082 CTGGCTGAAGATCAGTAGGCAGG + Intergenic
1124541698 15:30592039-30592061 CTGGCTGAAGATCAGTAGGCAGG + Intergenic
1124548358 15:30653834-30653856 CTGGCTGAAGATCAGTAGGCAGG + Intronic
1124756908 15:32415258-32415280 CTGGCTGAAGATCAGTAGGCAGG - Intergenic
1126588342 15:50313149-50313171 CTGACTCAAAATGAAAAGGTGGG + Intronic
1129770281 15:78199131-78199153 CTGTCTCAAAAAAAGAAGGAAGG - Intronic
1129795603 15:78374014-78374036 CTGTGTCAACATGAGGAGGGAGG - Intergenic
1130036119 15:80363082-80363104 CTGTCCCACCATGAATAGGCTGG + Intronic
1132491930 16:236608-236630 CTGTCTCAAAATAAATAGGCCGG + Intronic
1135764779 16:25168051-25168073 CTGTCTCAAAAAAAAAAGGCTGG - Intronic
1135890731 16:26354759-26354781 CTGGCTTAAAATGAGGAAGCAGG + Intergenic
1135928881 16:26719626-26719648 CTGGCTCCAAACGTGTAGGCAGG + Intergenic
1136128038 16:28199571-28199593 CTGTCTCAAAATAAAAAGGCCGG - Intronic
1137839184 16:51624358-51624380 TTGTCTCCAAATGAGCCGGCAGG - Intergenic
1138406774 16:56801744-56801766 GTGTTTCTAAATGAGTAGCCTGG + Intronic
1138582495 16:57950761-57950783 CTGTCTCAAGAGGAGAAGGGGGG - Intronic
1139731697 16:68951312-68951334 CTGTCTCAAAAAAAAAAGGCAGG + Intronic
1140301740 16:73764601-73764623 CTGGCTCAAGATGAGAAGGAAGG + Intergenic
1140996611 16:80266070-80266092 CCCTCTCAAAATGAGGAGGATGG + Intergenic
1143791129 17:9296335-9296357 CTGTCTCAAAAAAATTAGCCAGG + Intronic
1144387519 17:14763231-14763253 CTGTTTACAAATGAGTAGTCAGG - Intergenic
1145869556 17:28262372-28262394 CTGACTAAAATTTAGTAGGCAGG - Intergenic
1147450259 17:40499909-40499931 CTGTGTCCAAATTAGTAAGCAGG - Intronic
1147682099 17:42256249-42256271 CTGTCTCAAAAAAAGTTGGGGGG - Intronic
1148396061 17:47309050-47309072 CTGTCTCAAAAAAAGAAGGAAGG - Intronic
1148996100 17:51711170-51711192 CTCTGTGAAAATGATTAGGCAGG + Intronic
1149874077 17:60213047-60213069 TTGTATTAAAATGAATAGGCCGG - Intronic
1150087857 17:62290317-62290339 TTGTATTAAAATGAATAGGCCGG - Intergenic
1150473658 17:65458208-65458230 CTGTCTCAAAAAGAGAAAACTGG - Intergenic
1155387115 18:25290483-25290505 CTGACTGCAAATGAGTAGACAGG + Intronic
1159666590 18:71168985-71169007 CTTTCTCAAAATGTGTGGTCTGG - Intergenic
1160819269 19:1050112-1050134 CTGTCTCAAAATAAATAGGGCGG + Intronic
1161096591 19:2395709-2395731 CTGTCTCAAAACAAACAGGCCGG + Intronic
1161166088 19:2788480-2788502 CCGTCTCAAAAAAAATAGGCAGG - Intronic
1161796361 19:6388939-6388961 CTGTCTCAAAATAAATAAGTAGG + Intronic
1162672325 19:12267342-12267364 TTGGCTGAAAATGAGTAGGCAGG - Intronic
1163850558 19:19660781-19660803 CTGTCTCAAAATAAAAAGGCTGG + Intronic
1166138224 19:40790373-40790395 CTGTCTCAAAATAAAAAGACAGG - Intronic
1168265543 19:55222120-55222142 CTGTCTCAAAATAAATAGCCTGG - Intergenic
1168451010 19:56466589-56466611 CTGTCTTAAAGTGAGTAGCTAGG + Intronic
926090388 2:10045139-10045161 CTGTCTCAAAAAAACAAGGCCGG + Intronic
932199003 2:69809479-69809501 CTGTGTCAAAAAAAATAGGCAGG - Intronic
932262152 2:70335972-70335994 CTGTCTTAAAATAAATAGGCCGG - Intergenic
933577290 2:84083720-84083742 CTTTCTCATTATGAGTAAGCAGG + Intergenic
936251535 2:110871853-110871875 GAGTCTCAGAATGAGTGGGCAGG - Intronic
940322170 2:152389280-152389302 CTGTCTCCAAACCAGGAGGCAGG - Intronic
940693327 2:156947182-156947204 CTGTTTTAAAATGAGATGGCTGG + Intergenic
942832519 2:180253730-180253752 CTGTCTCACAGTGAGTGGTCTGG + Intergenic
946340836 2:219067192-219067214 CTGTCTCTAAATAAATAGGCTGG + Intergenic
946633063 2:221692747-221692769 CTGTCTCAAATTAAGTAAACAGG - Intergenic
947952208 2:234158107-234158129 CAGTTTCAAAATGAGGGGGCTGG + Intergenic
948719873 2:239892869-239892891 CTATCTACAAATGTGTAGGCAGG + Intronic
1170218478 20:13916799-13916821 CTGTCTCAAAAAAAGGTGGCGGG + Intronic
1171354237 20:24531903-24531925 CTATCTCACAGTGAGTAAGCAGG + Intronic
1173762899 20:45579394-45579416 CTTTCTCAACATGGGCAGGCTGG + Intergenic
1178192866 21:30306078-30306100 CTGCCTCAATATTAGGAGGCAGG + Intergenic
1178492092 21:33059032-33059054 TTGTCTCCAAATGAGGAGACAGG - Intergenic
1179122570 21:38561672-38561694 CAGTCTCAAAGTCAGTTGGCTGG + Intronic
1179625144 21:42645027-42645049 CTGGCTCATAAGGAGTGGGCTGG + Intergenic
1179983031 21:44906197-44906219 CTGTCTCAAAATGAAAAGAAAGG - Intronic
1179998695 21:44985478-44985500 CCGTCTCAAAGTGAGAAGTCTGG + Intergenic
1181418782 22:22782043-22782065 CTGCCTAAAAAGTAGTAGGCTGG + Intronic
1182373339 22:29827794-29827816 GTGTGTCAGAATGAGTAGCCTGG - Intronic
1182596378 22:31424151-31424173 CTGTCTCAAAAAAAAAAGGCCGG - Intronic
1184478369 22:44733779-44733801 CTGTGTTACAATGAGTAGGTGGG - Intronic
949094853 3:74128-74150 CTTTCTGTAAATGAGTAGCCAGG + Intergenic
949652063 3:6171251-6171273 CTGTGTCAACTTGAGTGGGCTGG + Intergenic
950164685 3:10785393-10785415 TTGTCTCAAAATAAAAAGGCAGG - Intergenic
952390473 3:32875115-32875137 CTGTCTAAAAAGCATTAGGCCGG - Intronic
952641073 3:35596895-35596917 GAGTCTCAAAATGGCTAGGCAGG + Intergenic
954350260 3:50037399-50037421 CTGTCTCAAAAAAAGCAGGGGGG + Intronic
954805483 3:53217577-53217599 CTGTCTCAAAAAAAAAAGGCAGG - Intergenic
955458293 3:59150166-59150188 TTGTCTCAGCCTGAGTAGGCGGG + Intergenic
956401418 3:68883925-68883947 CTGTCTCAAAAAAAGAAGGCAGG + Intronic
958135280 3:89480907-89480929 CCGCCTCAAAATGTGTAAGCAGG + Exonic
962545968 3:136435962-136435984 CTGTCTCAAAAAAAACAGGCTGG - Intronic
962912404 3:139864971-139864993 TTGTCTGGAGATGAGTAGGCAGG - Intergenic
963418944 3:145034580-145034602 CTGTCTCTAAATGCTCAGGCTGG + Intergenic
965727618 3:171735741-171735763 CTTACACAAAATAAGTAGGCTGG - Intronic
966476824 3:180358375-180358397 CTGAGTCAAGATGAGGAGGCAGG - Intergenic
966479391 3:180389073-180389095 CTGCCTTACAATTAGTAGGCCGG + Intergenic
967452720 3:189644966-189644988 CTGTCTCAAACTGAATTGGGTGG - Intronic
968076738 3:195820063-195820085 CAGTATCAAAATGAGAAGCCTGG - Intergenic
969121137 4:4912250-4912272 CTGTCTCAAAATAAGTAAATAGG + Intergenic
970088926 4:12380946-12380968 CTGTATCAAAATCTCTAGGCTGG + Intergenic
971324796 4:25634982-25635004 CTGTCTAAAAATAAATAGGCCGG + Intergenic
972517475 4:39821699-39821721 CTGTCTCAAAAATAATAGGCTGG - Intergenic
977251667 4:94695363-94695385 ATGTCTTAAAATGACAAGGCTGG + Intergenic
978297014 4:107217259-107217281 AAGTCTCAGAGTGAGTAGGCTGG - Intronic
978737836 4:112104236-112104258 CTCTCTCAGTATGAGTAGCCTGG + Intergenic
978915236 4:114118043-114118065 AAGTATGAAAATGAGTAGGCTGG - Intergenic
981358651 4:143821965-143821987 CTGTCTCAAAAAAAGAAGGATGG - Intergenic
981785235 4:148470182-148470204 CTCACTCAGAATGAGGAGGCAGG + Intergenic
987800248 5:22686666-22686688 CTGTCTCTTAATCAGTAGGATGG + Intronic
989281514 5:39649316-39649338 CTCTCACAAAAAGACTAGGCCGG - Intergenic
990378436 5:55196846-55196868 CTTTTTAAAAATGTGTAGGCTGG + Intergenic
995567988 5:113451712-113451734 CTGTCTCAAAAAAAGAAGGAAGG + Intronic
997356944 5:133268608-133268630 CTGTCTCAGGATGAGCAGGAAGG - Intronic
997768494 5:136529165-136529187 CAGTCTTAAAATGACTATGCTGG + Intergenic
999350167 5:150862443-150862465 TTGTCTCTCAATGAGGAGGCTGG - Intronic
1003682082 6:8266414-8266436 CTGTCTCAAAATGTGGTGCCAGG - Intergenic
1004134141 6:12950402-12950424 CTCTCTGAATCTGAGTAGGCTGG - Intronic
1004209068 6:13619080-13619102 CTGCCTGAATAAGAGTAGGCTGG - Intronic
1005042610 6:21612790-21612812 CTGTATCTAAAGGAGGAGGCTGG - Intergenic
1006739969 6:36301123-36301145 CTGTCTCAAAAATAGTGGGTGGG - Intronic
1007094296 6:39203865-39203887 CTGTCTAAAAAGGAGTATGCAGG + Intronic
1011592614 6:88985064-88985086 CTGTCTCAAAAAGAAAAGCCAGG + Intergenic
1011964649 6:93139625-93139647 CTTTCTCTAAATGACTAGACAGG + Intergenic
1013612423 6:111807693-111807715 GTGTCTCCAAATGAATAGGTTGG + Intronic
1014443284 6:121497750-121497772 CTGTCTCAAAAAAAAAAGGCCGG - Intergenic
1017864247 6:158429141-158429163 CTGTCTCAAAATAATTAGTCGGG - Intronic
1019009651 6:168833754-168833776 CTGACTCAAAATCAGTACTCTGG + Intergenic
1023182229 7:37496451-37496473 CTGTCTCAAAACAAACAGGCTGG - Intergenic
1024175882 7:46840700-46840722 TAGTCTCAAAATTTGTAGGCAGG - Intergenic
1026952133 7:74354608-74354630 CTGTCTCAAAAAAATTAGCCAGG + Intronic
1028858569 7:95620812-95620834 CAGACTCAACATGAGTTGGCTGG + Intergenic
1030187499 7:106778096-106778118 ATGTCACAAAATGAGAAGTCAGG + Intergenic
1030847517 7:114439190-114439212 CTGTTTTCAAATGAGTTGGCTGG + Intronic
1032321925 7:130893543-130893565 CTTACTCAAACTGAGTAAGCTGG + Intergenic
1035998497 8:4575547-4575569 CTGTCTCAAAGTGAGTTTGATGG - Intronic
1036438802 8:8761461-8761483 CTGTCTCAAAAAGATAAGGCTGG - Intergenic
1036460769 8:8950543-8950565 CTGTCTCAAAAACAACAGGCTGG + Intergenic
1041511421 8:58659029-58659051 CTGTGTCTAAAGGAGTCGGCAGG + Intronic
1041660346 8:60395128-60395150 CTGTCTCAAAAAGGGGAGGGGGG + Intergenic
1043994954 8:86802116-86802138 CTCTCTCAAAATGAGTAGGAAGG + Intergenic
1044269011 8:90218172-90218194 CTGACTTAAAATGATTAAGCTGG - Intergenic
1046872387 8:119218074-119218096 CAGTCTCAAAATGAGGATGGTGG + Intronic
1052203333 9:25808736-25808758 CTGTCACAATAGGAGGAGGCTGG + Intergenic
1052464000 9:28806457-28806479 AATTCTCAAAATTAGTAGGCTGG - Intergenic
1053227609 9:36374478-36374500 CTGTCTCAAAAAGAGATGTCGGG - Intronic
1053410042 9:37910038-37910060 CTGTCTCAAAATAAACAGGCCGG - Intronic
1056176552 9:84042104-84042126 CTGTCTAAAATTTACTAGGCAGG - Intergenic
1056329817 9:85511956-85511978 CTGTCTCAGACTGAATGGGCAGG - Intergenic
1057135940 9:92687994-92688016 CTGTCTCAAAAAAAGGAGGAGGG - Intergenic
1059794868 9:117683176-117683198 CTTTCTCAAAATGAGTTGGTTGG + Intergenic
1060642729 9:125252405-125252427 CTGTCTCAAAAAAAAAAGGCCGG - Intergenic
1189522137 X:41780943-41780965 CTGTCTCAAAAATAATAAGCCGG - Intronic
1193112917 X:77747515-77747537 CTGTCTCAAAAAAAGGGGGCGGG + Intronic
1196414550 X:115456781-115456803 CTGTCTCAAAAACAGAAGTCCGG + Intergenic
1197721581 X:129748411-129748433 CTGATTCATAATCAGTAGGCTGG - Intronic
1198960389 X:142175912-142175934 CTGTCTGAAATGGAGTAGGAAGG + Intergenic