ID: 1113879991

View in Genome Browser
Species Human (GRCh38)
Location 13:113619659-113619681
Sequence TCTGAAGTGCTGCTCGGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113879983_1113879991 -6 Left 1113879983 13:113619642-113619664 CCCTATCTCCAGGCCCTTCTGAA 0: 1
1: 1
2: 2
3: 23
4: 235
Right 1113879991 13:113619659-113619681 TCTGAAGTGCTGCTCGGGGCCGG 0: 1
1: 0
2: 0
3: 15
4: 179
1113879984_1113879991 -7 Left 1113879984 13:113619643-113619665 CCTATCTCCAGGCCCTTCTGAAG 0: 1
1: 0
2: 5
3: 34
4: 290
Right 1113879991 13:113619659-113619681 TCTGAAGTGCTGCTCGGGGCCGG 0: 1
1: 0
2: 0
3: 15
4: 179
1113879982_1113879991 -5 Left 1113879982 13:113619641-113619663 CCCCTATCTCCAGGCCCTTCTGA 0: 1
1: 0
2: 3
3: 29
4: 267
Right 1113879991 13:113619659-113619681 TCTGAAGTGCTGCTCGGGGCCGG 0: 1
1: 0
2: 0
3: 15
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113879991 Original CRISPR TCTGAAGTGCTGCTCGGGGC CGG Intronic
902514631 1:16983522-16983544 GCTGAACTGCTGCTCTGAGCCGG - Intergenic
902935198 1:19759971-19759993 TCTTTTGTGCTGCTTGGGGCAGG - Intronic
903144542 1:21362544-21362566 TGGGAAGTGCTGCTAGGGACTGG + Intergenic
903320968 1:22543008-22543030 TGTGAAGTGGTGGACGGGGCGGG - Intergenic
904209016 1:28873562-28873584 GCTGAAGTCCAGCTCAGGGCAGG + Intergenic
905923041 1:41731733-41731755 TCTGAAGGCCTGATTGGGGCTGG - Intronic
906254590 1:44338358-44338380 TCTGAAGGCCTGACCGGGGCTGG + Intronic
907272574 1:53299487-53299509 TCTGGAGTGCTCCTCTGTGCTGG + Intronic
907677902 1:56535686-56535708 TCTGAAGCTCTGCTTGGGGAAGG + Intronic
909483970 1:76153836-76153858 TCTGAAATGATGCTCTTGGCTGG + Intronic
909642245 1:77882141-77882163 TCTGAAGGCCTGATTGGGGCTGG + Intergenic
911321075 1:96414771-96414793 TCTGAAGTGCCACTGAGGGCAGG - Intergenic
916434042 1:164760162-164760184 TCTTGACTACTGCTCGGGGCTGG + Intronic
917623738 1:176824868-176824890 TCTGAAATGCTGTTAGGGTCTGG + Intronic
918207451 1:182322195-182322217 TCAGAATTGCTCCTCTGGGCTGG - Intergenic
918459779 1:184764739-184764761 TCTGAAGTTCTGCTCATGGCTGG - Intergenic
920506354 1:206518093-206518115 TGAGAAGTGAGGCTCGGGGCAGG + Intronic
922078664 1:222272848-222272870 TCTGAAGTTCTGTTAGGTGCAGG + Intergenic
923942654 1:238844747-238844769 GCTGTGGTGCTGGTCGGGGCAGG + Intergenic
923986397 1:239387069-239387091 ACTGAAGGGCGGCTCCGGGCAGG + Intronic
924325533 1:242890811-242890833 TCTGAGGTGCTGCCCAGGACGGG + Intergenic
1063704686 10:8419482-8419504 CCTGCAGTGCTGGTCAGGGCAGG + Intergenic
1064414559 10:15137255-15137277 TCTGAAGTCCAGCTGGAGGCAGG + Intronic
1070642031 10:78177226-78177248 TCCGCAGTGCTGGGCGGGGCCGG - Intergenic
1073275380 10:102305873-102305895 TGTGAAGTACTGTTCTGGGCAGG + Intronic
1073463344 10:103679164-103679186 TCACAAGTGCTGCACGGGGCTGG - Intronic
1073863108 10:107770287-107770309 TCTGAAGATCTGCTCAGAGCAGG - Intergenic
1075090613 10:119442221-119442243 TCTGCAGGGCTGCTGGGGGGCGG + Intronic
1076128389 10:127993917-127993939 TCTCAGTTGCTGGTCGGGGCAGG + Intronic
1076872647 10:133201299-133201321 CCTGAACTGCCGCACGGGGCCGG - Intronic
1076945032 10:133640737-133640759 TCGGAGGGGCTGCGCGGGGCCGG - Intergenic
1077272688 11:1689198-1689220 TTTGAAGTGCGGGTTGGGGCAGG + Intergenic
1078466675 11:11555175-11555197 CCTGATGGGCTGCTCAGGGCGGG + Intronic
1083301068 11:61739841-61739863 CCTGGAGTCCTGCTCAGGGCTGG - Intronic
1083991547 11:66249158-66249180 TCTGATGTTCTTCTCGTGGCTGG + Intergenic
1084712424 11:70852328-70852350 TCTGAAGGGCTTCTCTGGGATGG - Intronic
1085457886 11:76675529-76675551 TCTGCGGTGGGGCTCGGGGCAGG + Intergenic
1086347927 11:85916636-85916658 TCTGAAGGCTTGATCGGGGCAGG + Intronic
1087712180 11:101567047-101567069 GCTGAAGTCTGGCTCGGGGCGGG + Intronic
1089642336 11:119856075-119856097 TCTGAAGGCCTGATAGGGGCTGG + Intergenic
1089897152 11:121942104-121942126 TCTGAAGTCTTGATAGGGGCTGG - Intergenic
1091323709 11:134668918-134668940 TCTGATGTGCTGCCTGGGGCTGG + Intergenic
1103240851 12:119412187-119412209 TCAGGAGAGCTGCTTGGGGCTGG - Intronic
1103764165 12:123269985-123270007 CCTGAAGTCCTGTTCTGGGCTGG - Intronic
1104643780 12:130483491-130483513 GCTGCAGTCCTGCTGGGGGCTGG + Intronic
1104724137 12:131065840-131065862 TCTGAATTTCTGCTCCTGGCTGG + Intronic
1106863557 13:33937807-33937829 TCTAATGTGCTCCTCAGGGCAGG + Intronic
1108702469 13:52955519-52955541 TCAGGCGTGCTGCTGGGGGCTGG - Intergenic
1113879991 13:113619659-113619681 TCTGAAGTGCTGCTCGGGGCCGG + Intronic
1114065123 14:19053798-19053820 TCTGCACTGCTGTTGGGGGCAGG + Intergenic
1114097140 14:19346204-19346226 TCTGCACTGCTGTTGGGGGCAGG - Intergenic
1115028957 14:28772772-28772794 GCTGAAGTGGTGTTGGGGGCAGG - Exonic
1115531462 14:34331969-34331991 TCTGTAGTGCTGGTTGGGGCAGG - Intronic
1119292663 14:73508038-73508060 TCTGAAATGCAGCTGGGGCCGGG - Intronic
1121279202 14:92687431-92687453 TCTGAGGAGCTGCGTGGGGCAGG - Intronic
1121782419 14:96630443-96630465 TCTGAAGGCCTGAGCGGGGCCGG + Intergenic
1122422900 14:101588652-101588674 TCAGAGGTGCTGCTGGGGGTGGG - Intergenic
1122829911 14:104390823-104390845 TCTGAAAGGCTGCTGGGGCCTGG + Intergenic
1124123070 15:26909091-26909113 TCTGAAATGCAGCTGTGGGCAGG + Intronic
1125675723 15:41501669-41501691 CCTGAAGCGCTGCTCGGAGCCGG + Exonic
1126546758 15:49882256-49882278 TCACAACTGCTGCTCTGGGCTGG - Intronic
1130351990 15:83100935-83100957 TCTGAAGTTCTGCTCAGTGTAGG - Intergenic
1132042553 15:98537215-98537237 TCTGAAGTGAGGCTGGGGTCTGG - Intergenic
1132618024 16:851955-851977 TCTGAAGGGGTGCTCGGGGTGGG - Intergenic
1136242458 16:28952418-28952440 TCTGTAGTCCTGGGCGGGGCAGG + Intronic
1136270802 16:29147100-29147122 TCTGAAGTCCTGACCGGGGCTGG - Intergenic
1136277955 16:29190704-29190726 CTTGAGGTGCTGCTGGGGGCTGG + Intergenic
1137548383 16:49419476-49419498 TCTGGAGTGAGGCTCAGGGCTGG + Intergenic
1138084720 16:54123021-54123043 TCTGAGCTGGTGCTTGGGGCAGG + Intergenic
1138133208 16:54499808-54499830 TCTGAAGTCCTGCACCGTGCTGG + Intergenic
1138207132 16:55133328-55133350 TCTGATGTGCTGCTCTGACCAGG - Intergenic
1138551105 16:57748968-57748990 TATCAGGTGCTGCTGGGGGCTGG - Intronic
1138889160 16:61121324-61121346 TCTGAAATGATGCTCGAGACAGG - Intergenic
1139423779 16:66866351-66866373 TCTGAAGAGCATCTCGGGGAAGG - Intronic
1140122988 16:72099296-72099318 TCTGAGGGGCTGATCGGGGCTGG + Intronic
1141280654 16:82627563-82627585 GCCGAAGCGCTGCTCGGGTCCGG + Intronic
1142074383 16:88108880-88108902 TCTGAAGTCCCGACCGGGGCTGG - Intronic
1142082329 16:88156744-88156766 CTTGAGGTGCTGCTGGGGGCTGG + Intergenic
1142140175 16:88469237-88469259 TCTGAAGTGCCGGCCGGGCCAGG + Intronic
1142338662 16:89507036-89507058 TCGGCAGAGGTGCTCGGGGCTGG - Intronic
1142383491 16:89747410-89747432 TTTGAAGTGCTGCACAAGGCCGG + Intronic
1142560093 17:804667-804689 TCTGAAGAGCTGCTCCAGCCCGG - Intronic
1143951729 17:10638026-10638048 TCTAAGGTGCTGCGCGGGGTGGG - Exonic
1144642163 17:16943625-16943647 GCTGATGTCCTGCTGGGGGCAGG - Intronic
1147162700 17:38577360-38577382 TCTGAAGTCCTTCTGGGAGCAGG - Intronic
1148823605 17:50376091-50376113 TCTGCAGTGCTCCTAGGAGCTGG - Exonic
1150447454 17:65238137-65238159 CCTGAAGGGCTGCCCAGGGCAGG - Intergenic
1153926068 18:9836127-9836149 GCTGCTGTGCTGCTCGTGGCCGG + Intronic
1155390014 18:25325471-25325493 CCTGCAGTGGTGCTGGGGGCAGG - Intronic
1155532198 18:26778416-26778438 TCTGAAATGCAGCTAGGGGCTGG + Intergenic
1157220704 18:45826790-45826812 ACTGGAGTCCAGCTCGGGGCTGG + Intronic
1158388990 18:57027593-57027615 TCTGAAGTGCTGCTTGAATCTGG + Exonic
1160517002 18:79484147-79484169 TCTGCAGTGGTGCCCAGGGCAGG - Intronic
1161152191 19:2715518-2715540 TCTGAAGGCCTGATCGGGGAAGG - Exonic
1161220381 19:3115648-3115670 TCTGGAGTGCTGGCCGGAGCAGG + Intronic
1161770097 19:6226361-6226383 TCTGAATTGCTGCTCAGGGATGG + Intronic
1162725584 19:12688270-12688292 GCTGAAGTTCTGCACGGAGCAGG + Intronic
1164474238 19:28562911-28562933 TCTGATGTGCTGCTTGAGGTTGG + Intergenic
1164625598 19:29725643-29725665 TCTGAAGGGGTGCTTGGGCCTGG + Intergenic
1165051062 19:33142018-33142040 TTTGAGGTGTTGCTGGGGGCAGG + Intronic
1165862864 19:38918314-38918336 GCTGCTGAGCTGCTCGGGGCAGG + Intronic
1168245249 19:55109903-55109925 TCAGCCGTGCTGCTCGGGGTGGG - Intronic
924968571 2:101249-101271 TCTGCAGTGCTGTCTGGGGCTGG + Intergenic
925708727 2:6716227-6716249 TCTGAACTCCTGCTCAGGGATGG - Intergenic
926285325 2:11483013-11483035 TGTGCGGGGCTGCTCGGGGCGGG + Intergenic
927207553 2:20619611-20619633 TCTGAAGTGCTGTACAGAGCGGG - Intronic
927470939 2:23376070-23376092 TCTGCAGTGCTACCTGGGGCAGG - Intergenic
927539143 2:23891735-23891757 TCTGAGGTGGGGGTCGGGGCGGG - Intronic
928234897 2:29530807-29530829 TCTGAAATGCCTCTCTGGGCTGG - Intronic
929238095 2:39627461-39627483 TCTAAACTGCTACTCTGGGCAGG + Intergenic
938482377 2:131672801-131672823 TCTGCACTGCTGTTGGGGGCAGG + Intergenic
938490875 2:131760409-131760431 TCAGAAGTGCTCCTGGGGTCTGG + Intronic
942426017 2:175861822-175861844 TCAGAAGAGATGCTGGGGGCTGG - Intergenic
945064433 2:205936710-205936732 TGTGAAGGGATGCTGGGGGCCGG + Intergenic
945221863 2:207491609-207491631 TGTGAAGTCCTGCTTGGGGTAGG - Intergenic
946850886 2:223906255-223906277 TATGGAGTGCTGATCTGGGCAGG - Intronic
947600644 2:231447614-231447636 TATGAAATGTTGCTCTGGGCCGG + Intergenic
948086623 2:235255895-235255917 TCGGAAGTGCTGCTGTGGGGAGG + Intergenic
1170589989 20:17764611-17764633 TGTGAGGGGCTGCTGGGGGCTGG + Intergenic
1172096070 20:32461080-32461102 GCAGAGGTGCTGCTCGGGGTGGG + Intronic
1172825980 20:37786361-37786383 TCTGTAGAGCTGCCTGGGGCTGG - Intronic
1174305174 20:49609909-49609931 TGTGAACAGCTGCTGGGGGCAGG - Intergenic
1175390308 20:58622953-58622975 TGTGAAGTGCTGATCGCAGCTGG - Intergenic
1175431089 20:58903718-58903740 TCTGAACTGGTTCTCGGGGTTGG - Exonic
1176256850 20:64157397-64157419 TCTGAAGTTCTGCTCGAGAAAGG - Intronic
1176708011 21:10129279-10129301 TCAGAAGTGCTCCTGGGGTCTGG + Intergenic
1179205766 21:39276668-39276690 TCTGAAGTACTGGTCAGGGTTGG - Intronic
1179243487 21:39611459-39611481 TCTGATGTGCTTCTTGGTGCAGG + Intronic
1180483613 22:15776418-15776440 TCTGCACTGCTGTTGGGGGCAGG + Intergenic
1180854461 22:19037403-19037425 TCTGTGGTGCTGCTCGGGGATGG - Exonic
1181458012 22:23070526-23070548 TCTGCCGAGCTGCTCCGGGCAGG - Exonic
1182840041 22:33381937-33381959 TCTGTAGCACTGCTCGGAGCGGG + Exonic
1184352979 22:43956996-43957018 TCAGAAGTCCTGCTCCCGGCAGG - Intronic
1184769591 22:46589514-46589536 TCTGAAGACCTGCTGGGGCCAGG + Intronic
1184837911 22:47035002-47035024 TCTGAAGCTCTCCTGGGGGCAGG + Intronic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
953530729 3:43737560-43737582 TCAGAAGTTCTGCTCTGGACAGG + Intergenic
953808435 3:46091589-46091611 TCTCAGTTGCTGCTCAGGGCTGG + Intergenic
954658869 3:52215712-52215734 TCTGAAGTGCATCTCAGGCCCGG + Intergenic
960974552 3:123161697-123161719 TCTCACTTGCTGGTCGGGGCTGG + Intronic
961674671 3:128557235-128557257 TGTGAGGTGCAGCTCTGGGCTGG + Intergenic
962793931 3:138834813-138834835 AGTGTAGTGCTGCGCGGGGCAGG - Intronic
964154848 3:153572792-153572814 TCTGATGACCTGCTCTGGGCAGG - Intergenic
966912180 3:184565749-184565771 TCTGAGCAGCTGCTGGGGGCCGG + Intronic
969061729 4:4440963-4440985 TCTGAAGGGCTGACCAGGGCTGG + Intronic
969167388 4:5328909-5328931 TCTGAAGTCCAGCTGGTGGCCGG + Intronic
973551855 4:52043538-52043560 TCTGAACTGCTGCTCTGTGTGGG + Intergenic
984557028 4:181226630-181226652 TCTTAAGTCCTGCTCTGGTCAGG + Intergenic
984850628 4:184149536-184149558 TCTGAAGGCCTGCCCTGGGCAGG + Intronic
985448415 4:190041247-190041269 TCGGAGGGGCTGCGCGGGGCCGG - Intergenic
989394664 5:40941357-40941379 TCAAAAGTGCTCCTCGGGCCAGG - Intronic
997934098 5:138095788-138095810 TCTCACGTGCTGATAGGGGCAGG - Intergenic
998109283 5:139488566-139488588 CCGGAAGTGCTGGTCTGGGCTGG + Intergenic
1002284130 5:178151046-178151068 TTTTAAGTGCTGCCCTGGGCTGG + Intronic
1003195866 6:3914031-3914053 CCTGAAGGGCTGCTCTGGCCAGG + Intergenic
1006898194 6:37484034-37484056 CCTGCAGAGCTGCTCTGGGCAGG + Intronic
1014729859 6:125020089-125020111 TCTGAAGTTCTGCTGAGGGTGGG - Intronic
1019285896 7:222717-222739 CCTGGAGTGCTGCTTGGTGCTGG + Intronic
1021847303 7:24775551-24775573 TCTGAGAGGCTGCTTGGGGCAGG - Intergenic
1022334544 7:29410008-29410030 TCTGAGGTCGTGCTCAGGGCAGG - Intronic
1024205387 7:47155047-47155069 TTTGCAGTGCTTCTCTGGGCTGG - Intergenic
1027227264 7:76251668-76251690 TCCAAAGTGCTGCTGGGGGCCGG - Intronic
1031523860 7:122799957-122799979 TCTGAAGAGCTGCCAGAGGCAGG - Intronic
1032062465 7:128736548-128736570 ACTGAAGGACTGCTTGGGGCCGG - Intergenic
1032406457 7:131659466-131659488 TCTGGAGTGCAGCCTGGGGCTGG - Intergenic
1033167002 7:139048308-139048330 TGTCAAGTGCTACTCTGGGCAGG + Intronic
1034157413 7:148967006-148967028 TGGGAGATGCTGCTCGGGGCTGG + Intergenic
1035682060 8:1495415-1495437 TCTGCTGTGCTGCTCTGAGCCGG + Intergenic
1035748675 8:1979784-1979806 CCTGAAGTGCAGCTGGGTGCAGG + Intronic
1036939490 8:13037862-13037884 TCTGAAGGCCTGATTGGGGCTGG + Intergenic
1042675393 8:71315395-71315417 TCTGTAGCTCTGCTCTGGGCAGG + Intronic
1045350322 8:101332406-101332428 TCTTCAGGGCTGCTCGTGGCTGG - Intergenic
1046770382 8:118111756-118111778 TGCGAAGCGCTGCTCGGGGCCGG - Exonic
1047933051 8:129749662-129749684 TCTGAAGGGCTTCCCAGGGCAGG - Intronic
1049494378 8:142922822-142922844 TCTGCAGTGCTGTGCGGGGTGGG - Intergenic
1049554251 8:143274329-143274351 CCTGCAGTGCTGCTCTGGACCGG - Intronic
1049565396 8:143335375-143335397 TCTGAGGGGCTGCTGTGGGCTGG - Intronic
1053797860 9:41742320-41742342 TCTCTAGTTCCGCTCGGGGCCGG + Intergenic
1054186274 9:61954373-61954395 TCTCTAGTTCCGCTCGGGGCCGG + Intergenic
1054467074 9:65503675-65503697 TCTCTAGTTCCGCTCGGGGCCGG - Intergenic
1054652231 9:67634150-67634172 TCTCTAGTTCCGCTCGGGGCCGG - Intergenic
1055142540 9:72892252-72892274 CCTGGAGTGCTGCTGAGGGCTGG + Intergenic
1055777565 9:79782540-79782562 TCTGAAATGCATCTCGGAGCTGG - Intergenic
1056103602 9:83324885-83324907 TCTAAAGTGCTTGTCAGGGCTGG + Intronic
1056137955 9:83647672-83647694 TCTAAAGTGGTGCTTTGGGCTGG + Intergenic
1058535877 9:105959524-105959546 TCTGAAGTGGTGCACTGGGCGGG - Intergenic
1059230977 9:112721330-112721352 TCTGAAGGCCTGCCTGGGGCTGG - Intergenic
1062644725 9:137541703-137541725 TTTGAATCGCTGCTCGGGGGTGG - Intronic
1202792774 9_KI270719v1_random:98248-98270 TCAGAAGTGCTCCTGGGGTCTGG + Intergenic
1190593771 X:52032586-52032608 TCAGTAGTGCTGCTCTGGGCAGG + Intergenic
1195071267 X:101282643-101282665 TATGTAGTGCTGCTGGTGGCTGG - Intronic
1196806393 X:119590988-119591010 TGTGATGTGGTGCTTGGGGCAGG + Exonic
1197612482 X:128654774-128654796 ACTGAAAAGCTGCTTGGGGCTGG - Intergenic
1200075457 X:153548411-153548433 TCTGGAGTGCTGCTGGGGTTGGG - Intronic
1201223044 Y:11789804-11789826 TCTGAGGTGCTGCCCAGGACGGG + Intergenic