ID: 1113880467

View in Genome Browser
Species Human (GRCh38)
Location 13:113622700-113622722
Sequence AGAGCCGCAGCCTCTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 214}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113880460_1113880467 18 Left 1113880460 13:113622659-113622681 CCCGCTTGCTTCACCAGTGTTCT 0: 1
1: 0
2: 0
3: 19
4: 218
Right 1113880467 13:113622700-113622722 AGAGCCGCAGCCTCTGTGGAAGG 0: 1
1: 0
2: 3
3: 24
4: 214
1113880461_1113880467 17 Left 1113880461 13:113622660-113622682 CCGCTTGCTTCACCAGTGTTCTG 0: 1
1: 0
2: 1
3: 23
4: 166
Right 1113880467 13:113622700-113622722 AGAGCCGCAGCCTCTGTGGAAGG 0: 1
1: 0
2: 3
3: 24
4: 214
1113880464_1113880467 5 Left 1113880464 13:113622672-113622694 CCAGTGTTCTGAGGGCACCTGCA 0: 1
1: 0
2: 2
3: 20
4: 214
Right 1113880467 13:113622700-113622722 AGAGCCGCAGCCTCTGTGGAAGG 0: 1
1: 0
2: 3
3: 24
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113880467 Original CRISPR AGAGCCGCAGCCTCTGTGGA AGG Intronic
900132055 1:1091418-1091440 TAAGCCAGAGCCTCTGTGGAGGG - Intronic
900352129 1:2240171-2240193 AGGACAGCAGCCTCTGTGGTGGG - Intronic
901478050 1:9504483-9504505 ACAGCCACAGCCTCTAAGGACGG - Intergenic
903280894 1:22249243-22249265 AGGGACGCAGGCTCTGTGGGAGG + Intergenic
904314991 1:29654156-29654178 AGAGCTGCAGCCTCAGAAGAGGG + Intergenic
904329358 1:29747874-29747896 AGTGCAGTAGCCTCTGTGCAGGG + Intergenic
906297671 1:44659104-44659126 AGAGCCCCAGCCTCGGAGGTCGG + Intronic
906524933 1:46488421-46488443 AGAGCCCCAGCCTGGGTTGAGGG - Intergenic
907309383 1:53530567-53530589 AGAGCCACAGGATCTGTGAAGGG - Intronic
911136015 1:94441414-94441436 AGAGGTGCAGCCTTTGTGGAGGG + Intronic
912502601 1:110132025-110132047 AAAGCCCCAGCCTCTGGGGTGGG - Intergenic
912764456 1:112396206-112396228 GGAGCCTCAGCCGCTGTGGATGG + Exonic
915697214 1:157755865-157755887 AGAGTGGGAGCCTCTGAGGAAGG + Intronic
919017837 1:192063463-192063485 ATAGCCCCAGCACCTGTGGATGG + Intergenic
921932738 1:220768611-220768633 AGGGCCCCAGTCACTGTGGATGG + Intronic
922196126 1:223362566-223362588 ATAGCCTCAGCCTCCGTGGGCGG - Intronic
922748469 1:228060041-228060063 AGAGCCACAGCCCCCGTGGAAGG - Exonic
923730808 1:236547754-236547776 AGGGCCGCAGGCCCTGGGGATGG + Intronic
924874508 1:248087119-248087141 AGAGACACTGCCTTTGTGGAGGG - Intronic
1063271287 10:4513029-4513051 AGAACCCCAGCCTTTGTGCACGG + Intergenic
1064348029 10:14550334-14550356 AGAGCTGCAGACTCAGTGGTAGG - Intronic
1065917899 10:30367742-30367764 TGAGCACCAGCCTCTGGGGAGGG - Intronic
1065980649 10:30892662-30892684 TGAGCCGTTGCCTCTGAGGAGGG - Intronic
1066451695 10:35535889-35535911 TGACCCTCAGCATCTGTGGAAGG - Intronic
1067702758 10:48585573-48585595 TGAGCAGCAGCCTGTCTGGAGGG - Intronic
1070198909 10:74184449-74184471 ATAGTCCCAGCCTCTCTGGAGGG - Intronic
1070496778 10:77031675-77031697 AGAGATGCAGCCTCTGTTGGAGG + Intronic
1071470925 10:85983678-85983700 TGAGCCTCAGGCCCTGTGGATGG + Intronic
1071512833 10:86275277-86275299 AAAACAGCAGCCTCTGGGGAAGG + Intronic
1071564177 10:86663082-86663104 AGAGCTGCAGGCCCTGAGGAGGG - Intronic
1072435588 10:95412403-95412425 AGAGGAGGAGCCTCTGTGGATGG - Intronic
1072810494 10:98457745-98457767 AGAGCTGAAGCCTCAGTGGGAGG + Intronic
1074587222 10:114779946-114779968 AAAGCCACAGCCTCCCTGGAAGG - Intergenic
1075231060 10:120678485-120678507 TGAGCAGCTGCATCTGTGGAGGG - Intergenic
1076686535 10:132200695-132200717 AGAGCTGGTGCCTCTGTGCAGGG - Intronic
1076887637 10:133269848-133269870 AGAGCGGCAGCCTCTGTGCAGGG + Intronic
1077435352 11:2536303-2536325 AGAGCCGCAGGCAGTGCGGATGG - Intronic
1079483812 11:20912597-20912619 AGAGCCTTGGCCTCTGTGAAAGG - Intronic
1080776687 11:35393289-35393311 AGAGCAGCAGCCTCTCTGTAAGG + Intronic
1081678557 11:44985838-44985860 GGAGCGGCAGCCTGTGTGCATGG - Intergenic
1084648542 11:70474655-70474677 AAAGCCACAGCCACTGGGGAGGG + Intronic
1084712236 11:70851016-70851038 AGAGCCACAGCCACTGTTAATGG - Intronic
1085296681 11:75435352-75435374 TCAGCCGCAGCCTCTCTTGAGGG - Exonic
1090638364 11:128708070-128708092 AGAGACACAGCCTCAGTGAAGGG + Intronic
1091444390 12:535245-535267 CGAGGCTCAGCCTCTGGGGATGG - Exonic
1091993761 12:4977021-4977043 AGAGCCGGAGCCTCTGTTCTGGG - Intergenic
1092063599 12:5571097-5571119 CCAGCAGCAGCTTCTGTGGATGG - Intronic
1093261983 12:16950188-16950210 GGAGCCGCAGCCACTTTGGCTGG + Intergenic
1099996355 12:89783661-89783683 CTAGGGGCAGCCTCTGTGGAAGG + Intergenic
1101577787 12:106013962-106013984 AGAGCGGAGGCCTCTGTGGCAGG - Intergenic
1103887842 12:124216191-124216213 TGAGTCGTAGCCTCTGTGAATGG - Intronic
1105278409 13:18949333-18949355 AGAGCTGCAGCTTGTGTGGCAGG - Intergenic
1108072523 13:46642741-46642763 AGGACAGCAGCATCTGTGGAGGG + Intronic
1110656714 13:78008485-78008507 AGAGTCCCAGCCTGTGTGGTGGG - Intergenic
1113600796 13:111566827-111566849 AGAGCAGCATTCTATGTGGAGGG - Intergenic
1113842092 13:113366072-113366094 AGAGCCCCAGGCTCTGTGCAGGG + Intergenic
1113880467 13:113622700-113622722 AGAGCCGCAGCCTCTGTGGAAGG + Intronic
1114031457 14:18583982-18584004 GGAGCCGCAGCCCCGCTGGAGGG - Intergenic
1114216468 14:20661082-20661104 AAAGCAGCAGCCTCTGGGAAAGG - Intergenic
1117699184 14:58396185-58396207 AGTGCCTCAGCCTCTGCCGAGGG + Intronic
1117827724 14:59720856-59720878 AGAACAGCAGCTTCAGTGGAGGG + Intronic
1119846261 14:77832524-77832546 AGAGCCTCAGGCTCAGAGGAGGG - Intronic
1122745280 14:103894139-103894161 AAAGCCACAGCCCGTGTGGAGGG + Intergenic
1122873190 14:104650755-104650777 AGAGCCGCTGGGTCTGGGGATGG + Intergenic
1202834706 14_GL000009v2_random:69146-69168 TGAGCCTCTGCCTCTGTGGCAGG - Intergenic
1123632742 15:22273300-22273322 AGAGCCCCAGACTCTGCGGCTGG + Intergenic
1123666153 15:22610684-22610706 CGGGCAGCAGCCTCTGGGGAGGG - Intergenic
1124319976 15:28705090-28705112 CGGGCAGCAGCCTCTGGGGAGGG - Intronic
1124563934 15:30798247-30798269 GGAGCCGCAGCACCTGAGGAAGG + Intergenic
1129221295 15:74133299-74133321 AAGGCCGCAGCCGCAGTGGAAGG - Exonic
1130123795 15:81075147-81075169 AGAGCCACAGCATCTGTAGCAGG + Intronic
1132060160 15:98685807-98685829 GGAGCCGCAGCCTCCTTGGGTGG + Intronic
1132287234 15:100672175-100672197 ACAGCCACAGCCTCAGTAGAGGG + Intergenic
1132396256 15:101477021-101477043 AGTGCTGCAGCTGCTGTGGAAGG - Intronic
1132494172 16:252814-252836 AAAGCCGCACCCTCTGGGGAAGG - Intronic
1134590294 16:15447563-15447585 AGAGCACCAGACTCTGTGAAGGG - Intronic
1135605652 16:23822077-23822099 AAGGCCATAGCCTCTGTGGAGGG + Intergenic
1138282375 16:55781682-55781704 AGAGGAGCAGCCCCTCTGGAAGG - Intergenic
1138286571 16:55814962-55814984 AGAGGAGCAGCCCCTCTGGAAGG + Intronic
1139432402 16:66918185-66918207 AGAGCCTCAGCTCCTTTGGAGGG - Intronic
1139910597 16:70395163-70395185 GGGGCTGCAGCATCTGTGGAAGG + Exonic
1141135758 16:81464109-81464131 GGAGCCGCAGCCAGTGTGTAAGG + Intronic
1141429108 16:83961785-83961807 AGTGCCCCAGCCTCTAAGGAGGG + Intronic
1141970322 16:87477466-87477488 AGAGCCCCAGACTCTGCGGCTGG - Intronic
1142260185 16:89039182-89039204 TGAGCCACAGCGTATGTGGATGG - Intergenic
1143874340 17:9980488-9980510 ACATCCTCAGCTTCTGTGGAAGG - Intronic
1146109490 17:30075454-30075476 TGACCCCCAGCCTATGTGGATGG + Intronic
1146804524 17:35854795-35854817 AGAGCCAAAGCTTCTCTGGACGG - Intronic
1147932937 17:43994446-43994468 TGAGCCGCAGCCACCGTGTAAGG + Intronic
1148133215 17:45274677-45274699 ACAGCAGCAGCCTCTGTGTGTGG - Intronic
1151349648 17:73524300-73524322 AAAGCTCCAGCCTCTGGGGAAGG - Intronic
1152471679 17:80493001-80493023 AGAACCGCAGCCTTTCCGGAGGG - Intergenic
1152589510 17:81204425-81204447 AGAGACTCAGCCTGTGAGGAGGG + Intronic
1152677167 17:81647566-81647588 AGCTCAGCAGCCTCTGCGGAGGG + Intronic
1157299683 18:46470574-46470596 AGAGCCACAGGCTATGTTGATGG - Intergenic
1157312309 18:46561398-46561420 TGAGCCCCAGGCTCTGAGGAAGG + Intronic
1157320663 18:46631529-46631551 AAAGCCTCAGCCTCTCTGGACGG - Intronic
1157334980 18:46731501-46731523 AGAGCCCAGGCCCCTGTGGAGGG + Intronic
1159006493 18:63017538-63017560 AGAGCCTCAGCTTCTTTGAATGG - Intergenic
1160391030 18:78533320-78533342 ACAGCCCCGACCTCTGTGGAGGG - Intergenic
1160956015 19:1692025-1692047 GGAGCCGGAGCCTCTGTGTGTGG + Intergenic
1161221794 19:3121226-3121248 GCAGCCGCAGGCTCCGTGGAAGG - Exonic
1161949416 19:7459576-7459598 AGAGCTACAGCTACTGTGGATGG - Intronic
1163127739 19:15253407-15253429 TGAGCAGCAGCCTCAGTGGGAGG - Intronic
1163290318 19:16375569-16375591 AGAGCCACTGCCTCTGTGTAAGG + Intronic
1163683841 19:18699670-18699692 AGAGCCGCAACCTCAGGGGCAGG - Intronic
1164738051 19:30556444-30556466 GGAGAGGCAGCCTCTCTGGATGG + Intronic
1165203426 19:34163801-34163823 AGAGCCCCATCCTCTGTGGCAGG - Intergenic
1165982299 19:39735048-39735070 AAAGAGGCAGCCTCTGTGTATGG + Exonic
1167765266 19:51478540-51478562 AGACCGGCAGCCTCTGTGCCAGG + Intergenic
925187084 2:1855471-1855493 AGAGCCGCAGCCTCCCTGAAAGG - Intronic
925852342 2:8094694-8094716 AGAGCCGCAGCGTGTGCGGACGG + Intergenic
926153553 2:10437781-10437803 AGAGCAACAGTCTCTTTGGAGGG - Intergenic
927502245 2:23590628-23590650 GGATCCGCAGCCTCTGTGTGTGG - Intronic
927814592 2:26203512-26203534 AAAGCCCCAGACACTGTGGAGGG + Intronic
929120478 2:38480214-38480236 ATAGACCCAGCCTCTCTGGAGGG + Intergenic
931863539 2:66383249-66383271 AGAGAGGCAGCCTCCGTGGATGG - Intergenic
933014981 2:77113709-77113731 AGAGAAGCAGCCTGAGTGGATGG + Intronic
933157665 2:78993162-78993184 GGAGCCAGTGCCTCTGTGGAAGG - Intergenic
933975505 2:87506163-87506185 AGACCTACAGCCTCTGGGGAAGG + Intergenic
936081291 2:109434316-109434338 AGAGCAGCAGCTTCTGAGGGAGG + Intronic
936276635 2:111103393-111103415 AGAGCCGATACATCTGTGGAAGG + Intronic
936318321 2:111444650-111444672 AGACCTACAGCCTCTGGGGAAGG - Intergenic
936943806 2:117912906-117912928 AGAAGAGCAGCCTCTGGGGATGG - Intergenic
938496746 2:131801813-131801835 GGAGCCGCAGCCCCGCTGGAGGG + Intergenic
944662584 2:201933767-201933789 AGAGGAGCATCCTCTCTGGAGGG - Intergenic
944790158 2:203116816-203116838 AGAGCCACAGCCACTGTGCTGGG - Intronic
947931162 2:233966283-233966305 AGAGCCTCAGCCACTGAGAAGGG - Intronic
949011156 2:241679329-241679351 AGAGCCGCAGGCTCTGTGGGAGG - Intronic
1171884564 20:30642608-30642630 TGAGCCTCTGCCTCTGTGGCAGG + Intergenic
1171964479 20:31519002-31519024 AGAGGGGCTGCCTCTGAGGAGGG - Intronic
1172286001 20:33740871-33740893 AGAAGTGCAGCCTCTTTGGAAGG - Intronic
1172696833 20:36828753-36828775 AGAACCACAGCCGCTGTGGGAGG - Intronic
1173747323 20:45447859-45447881 AGAGCCTCAGCATCAGAGGAGGG - Intergenic
1173913601 20:46689350-46689372 AGAGCCTCAGCCTCCGGGGCGGG + Exonic
1174071867 20:47905172-47905194 AGAGAAACAGCCTCTGGGGAGGG + Intergenic
1175786854 20:61717338-61717360 AGAGCAGCAGCGTCTGTGGCTGG - Intronic
1176127328 20:63481879-63481901 GCAGCCACAGCCTCTGGGGAGGG + Intergenic
1176847456 21:13887574-13887596 TGAGCCTCTGCCTCTGTGGCAGG + Intergenic
1177867104 21:26525496-26525518 AGTGCTGAAGCCTCTGGGGAAGG - Intronic
1178728098 21:35073098-35073120 AGAGCTGCAGCCTCCGTGGATGG - Intronic
1180181646 21:46120913-46120935 GGAGCCACAGCCTCCGGGGAGGG + Intronic
1180363974 22:11923332-11923354 TGAGCCTCTGCCTCTGTGGCAGG - Intergenic
1180455570 22:15511039-15511061 GGAGCCGCAGCCCCGCTGGAGGG - Intergenic
1181067966 22:20315573-20315595 AGAGCTGCTGCCACTGGGGACGG - Intronic
1181534740 22:23535501-23535523 AGAGGCTCAGCCTCAGTGGGCGG - Intergenic
1183785764 22:40028283-40028305 GGAGCAGCAGCCTGTGTGGCAGG + Intronic
1184722950 22:46326028-46326050 AGAGCCGCAGCCTGTCTGGTGGG - Intronic
1184741244 22:46430155-46430177 AGAGACACAGCCACTCTGGAGGG + Intronic
1184988664 22:48153169-48153191 AGAGCCACAGCTTCTGGGGAAGG + Intergenic
1185134642 22:49062708-49062730 AGAGGCGGAGCCACCGTGGAAGG + Intergenic
950077950 3:10200475-10200497 AGAGGGGCAGCCTGTGAGGATGG + Exonic
951087561 3:18531578-18531600 AGAGTGGCAGCCTTTGGGGAGGG + Intergenic
952080836 3:29755635-29755657 AGAGCCAGAGCCTCAGAGGAGGG + Intronic
952757989 3:36889169-36889191 GGACTCTCAGCCTCTGTGGAAGG - Intronic
953244307 3:41176821-41176843 GCATCCGCATCCTCTGTGGAAGG - Intergenic
953406795 3:42663735-42663757 AGAAGAGCAGCCTTTGTGGAGGG - Intronic
954971643 3:54656401-54656423 AGACCAGCAGCCTCTGTTGGAGG - Intronic
955238095 3:57157414-57157436 AGACAGGCAGCCACTGTGGACGG + Intronic
960937737 3:122913594-122913616 AGTGCAGCAGCAACTGTGGAGGG - Exonic
961449466 3:126995940-126995962 GCAGCTGCAGCCTCTGTGCAGGG - Intronic
961679316 3:128588358-128588380 AGAGCCCCAGCCGGTGTGCAGGG - Intergenic
964655706 3:159064034-159064056 AGTGCCAAAGCCTCTGGGGATGG + Intronic
969967084 4:11008053-11008075 AGAGCAGCAGCCTGTGAGGCTGG + Intergenic
970371707 4:15413742-15413764 AAAGTTACAGCCTCTGTGGATGG + Intronic
970617709 4:17782859-17782881 AGAGACAAAGCCTCTGAGGATGG + Intergenic
973392831 4:49570531-49570553 TGAGCCTCTGCCTCTGTGGCAGG - Intergenic
976629343 4:87220604-87220626 CGAGCCGCGGCCTCTGGGGGCGG + Exonic
981355472 4:143784783-143784805 AGAGCAGCAGGCTCTGGGGTTGG - Intergenic
983382489 4:167015107-167015129 AGAGGAGCACCCTCTGTGAATGG - Intronic
984924882 4:184797913-184797935 AGCGCCACATCCTCTGTGGCAGG + Intronic
1202765319 4_GL000008v2_random:144404-144426 TGAGCCTCTGCCTCTGTGGCAGG + Intergenic
986313715 5:6572557-6572579 AGAGCCGAAGGCCCTGGGGAGGG - Intergenic
989442296 5:41487380-41487402 AGAGCAGAAGCCTTTGTGCAAGG + Intronic
994723414 5:103406812-103406834 AGAGCTGCATCCTCAGTGGAAGG - Intergenic
996753764 5:126915219-126915241 AAAGCAGCTGCCTCTGGGGAGGG - Intronic
997673341 5:135694303-135694325 CTAGCCACAGGCTCTGTGGAGGG + Intergenic
1000348798 5:160336700-160336722 GGAGGAGCAGGCTCTGTGGATGG - Intronic
1001449385 5:171812519-171812541 AGAGCTTGAGCCACTGTGGAGGG - Intergenic
1002131375 5:177084078-177084100 GGAGCATCAGCCTCTGTGGAGGG + Intergenic
1002250139 5:177923706-177923728 AGGGGCACAGCCTCTTTGGAGGG + Intergenic
1003886814 6:10529216-10529238 AGTGCCGAAGTCTTTGTGGATGG - Exonic
1004477267 6:15985306-15985328 AATGCTGCAACCTCTGTGGAGGG + Intergenic
1005249569 6:23929108-23929130 AGAGCCACAGTCTCTGAGGAGGG - Intergenic
1005835814 6:29708657-29708679 ACAGCCACAGCCTCTGGGTAGGG + Intergenic
1005889829 6:30127806-30127828 GGAGCCGCAGCCCCTCGGGACGG + Intergenic
1006743483 6:36325363-36325385 GGAGCCCCAGCCTCTGTAGATGG + Exonic
1007406572 6:41639016-41639038 GCAGCCGCAGCCTCTGTTCAGGG - Intronic
1012291577 6:97461898-97461920 AGGACTGCAGCCTCTGTGGGAGG - Intergenic
1013055144 6:106575896-106575918 AGATCTGCAGCCTCTGTGCCTGG - Intronic
1013851952 6:114526935-114526957 AGAGCAGCTGCCTCTCTGGTGGG - Intergenic
1015785950 6:136921961-136921983 AGAGCCGCTGGCTCTGTGGGGGG + Intergenic
1015953441 6:138576653-138576675 AAAGGCAGAGCCTCTGTGGAAGG + Intronic
1016017222 6:139198762-139198784 AGAGCTGCAGCCTGGGAGGAAGG - Intergenic
1017818344 6:158031045-158031067 TGAGTAGCAGCCTCTGGGGATGG + Intronic
1018027337 6:159816452-159816474 TGAGCTGCAGCCACTGTGGATGG + Intronic
1018275346 6:162124550-162124572 ATAACCGCAGGCTCTGTGGCTGG + Intronic
1018719740 6:166563464-166563486 GGAGCCGCAGCCCCTGGGGGTGG - Intronic
1019309130 7:351781-351803 AGAGCCGCTGGCTCCGGGGACGG - Intergenic
1020128464 7:5546261-5546283 AGAGGAGGAGCCTCTGTTGAGGG + Intronic
1020246574 7:6434031-6434053 ATAGCAGCAGCCTCCGTAGAGGG - Intronic
1022889131 7:34677753-34677775 ATGGCCCCAGCCTCAGTGGATGG - Intronic
1023000347 7:35801538-35801560 AGAGCCGCGGCCTCCGCGGCCGG + Intronic
1024270093 7:47635609-47635631 AGGGCAGCCCCCTCTGTGGAAGG + Intergenic
1026313202 7:69206240-69206262 AGAGCTGCAGCATTTGTTGATGG + Intergenic
1030638666 7:111979031-111979053 AGAGCCATAGCCTGTGTTGAGGG + Intronic
1031710066 7:125034387-125034409 AGAGCCCCAGGCTGAGTGGAAGG + Intergenic
1032117667 7:129130299-129130321 CCAGCCACAGCCTCTGGGGAAGG - Intergenic
1034899561 7:154899273-154899295 TGAGCTGAAGCCTCTGTGGCTGG - Intergenic
1035024025 7:155814991-155815013 AGAGCAGCAGCTTCTCTGGGGGG - Intergenic
1035087069 7:156269556-156269578 AGAGCCGTAGCTTGTGTGGAGGG + Intergenic
1035930820 8:3777911-3777933 AGACCCGCAGCCTCCTTGAAGGG + Intronic
1038153064 8:24959440-24959462 AGAGTCGCAGTCTCTTTAGAAGG + Intergenic
1038275914 8:26120474-26120496 AGAGCCCCAGATTCTGTGCATGG - Intergenic
1039857478 8:41428567-41428589 AGAGTAGTAGCCTCTGAGGAGGG + Intergenic
1039889371 8:41673784-41673806 AGAGCAGGTGCCTCTGTGGGTGG + Intronic
1042185586 8:66133348-66133370 GGAGCCACTGCCTCTGTGCAAGG + Intronic
1043328304 8:79080929-79080951 ACAGCAGCAGCCTCACTGGAAGG - Intergenic
1045059988 8:98402952-98402974 GGAGGAGCAGCCTCTGGGGAGGG + Intronic
1046918168 8:119699375-119699397 AGGGCCGCTGTCCCTGTGGAGGG - Intergenic
1047508969 8:125501744-125501766 AGAGCCCCACCCCCTGTGGCAGG - Intergenic
1049032417 8:140047636-140047658 ACAGCCACAGCCTCTGCTGAAGG + Intronic
1049092065 8:140523785-140523807 GCAGCCGTTGCCTCTGTGGAGGG + Intergenic
1056191173 9:84185618-84185640 AAAAACGCAGCCTCTGTGAATGG - Intergenic
1056787987 9:89606134-89606156 AGCGCGGCTGGCTCTGTGGAGGG + Exonic
1058360599 9:104142248-104142270 AGAGTCCCAGTCTCTGTGGGAGG - Intergenic
1061245672 9:129400336-129400358 AGAGGCTCAGCCTCGGTGGGTGG + Intergenic
1061825740 9:133257177-133257199 TGAGACGCAGCCTCTGGAGAAGG + Intronic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1062102752 9:134737136-134737158 AGAGCCTCTGCCCCTGTGGCTGG + Intronic
1062236017 9:135507978-135508000 AGAGCAGGACCCTCTGGGGAGGG + Intergenic
1062359340 9:136180116-136180138 AGAGCTGCAACCTCTGGTGAGGG - Intergenic
1062653254 9:137589445-137589467 AAAGCCGCAGCCGCTGGTGACGG + Intronic
1203546068 Un_KI270743v1:129293-129315 TGAGCCTCTGCCTCTGTGGCAGG + Intergenic
1185554322 X:1008528-1008550 GGAGCGGGAGCCTCTGTGGCAGG + Intergenic
1187298545 X:18026311-18026333 AGAGCCGCACCCTCTCGGGGAGG + Intergenic
1187505734 X:19876699-19876721 ATAGCAGCAGCCTATGGGGAGGG + Intronic
1187773828 X:22732368-22732390 AGAGGCCCAGTCTCTGTGCATGG - Intergenic
1188889121 X:35587795-35587817 ACACCTGCAGCCTCTGTGCATGG + Intergenic
1194897433 X:99461650-99461672 AAATCAGCAGCCTCTGTGGTTGG - Intergenic
1195087203 X:101423755-101423777 ACACCCCCAGCCTCTGGGGAAGG + Intronic
1199221098 X:145316405-145316427 ATAGCCCCAGCCTCTATAGAGGG + Intergenic