ID: 1113881335

View in Genome Browser
Species Human (GRCh38)
Location 13:113628490-113628512
Sequence CCACCCCTTAGATTTAACAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 76}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113881335_1113881345 24 Left 1113881335 13:113628490-113628512 CCGCTGTTAAATCTAAGGGGTGG 0: 1
1: 0
2: 0
3: 8
4: 76
Right 1113881345 13:113628537-113628559 TGCCTGCCTCCTGCTCCCAGAGG 0: 1
1: 0
2: 9
3: 104
4: 950

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113881335 Original CRISPR CCACCCCTTAGATTTAACAG CGG (reversed) Intronic
901762024 1:11478060-11478082 CCAGCCCTTATTTTTAAAAGAGG - Intergenic
908951214 1:69565765-69565787 CCACCACCTAGATTTAAGAAAGG + Intergenic
913087056 1:115448828-115448850 CCACCGCTCACATGTAACAGGGG - Intergenic
919127355 1:193411152-193411174 ATACCCCTTATTTTTAACAGTGG - Intergenic
920186502 1:204162622-204162644 CCAGCCCCTAGTTTTGACAGGGG - Intronic
923934959 1:238749285-238749307 CCACCCCTTAGTTGTAACTGGGG + Intergenic
924005355 1:239603635-239603657 CCAACCCTTTGCTTTACCAGAGG + Intronic
1063314130 10:4984880-4984902 CCACCCCTTAGCCCTCACAGGGG - Intronic
1069617953 10:69818156-69818178 CCACCCCTAGGACATAACAGCGG - Intronic
1072733082 10:97861183-97861205 CCATCCCTCTCATTTAACAGAGG + Intronic
1076682584 10:132181467-132181489 CCAGCCCTCATATTTTACAGAGG - Intronic
1078265364 11:9752089-9752111 CCATCCCATAGATTTCACAGAGG - Exonic
1080821487 11:35810868-35810890 CCACCCTTTACATTAAACAAGGG + Exonic
1084953762 11:72680664-72680686 CCAGCCCTTAGAGTTGGCAGTGG - Intergenic
1090995474 11:131861954-131861976 CCTCCCCTGGGGTTTAACAGTGG - Intronic
1091442820 12:524892-524914 CCACCACATGCATTTAACAGAGG - Intronic
1094399770 12:30049780-30049802 AAACCCCTTAAATTTTACAGTGG + Intergenic
1095959661 12:47826326-47826348 CCACACCTTAGAATTACCTGTGG - Intronic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1099279124 12:80620765-80620787 CCTATCCTTTGATTTAACAGTGG + Intronic
1102910866 12:116712998-116713020 CTCCCCGTTAGATTGAACAGAGG - Exonic
1103849266 12:123921072-123921094 CCACCCCTTGCATTTATCTGTGG + Intronic
1107271885 13:38628903-38628925 AAAGCCCATAGATTTAACAGTGG - Intergenic
1111429072 13:88128580-88128602 CCAAACCTTAAATTTAACAAAGG + Intergenic
1112050272 13:95638393-95638415 CCACCTCTTAGATTTAACTCAGG - Intronic
1113514038 13:110877480-110877502 CCACCACCCAGATTTAACATCGG + Intergenic
1113881335 13:113628490-113628512 CCACCCCTTAGATTTAACAGCGG - Intronic
1114568630 14:23650186-23650208 CCACCCCTTGGAATAAAAAGTGG + Intergenic
1116337073 14:43670175-43670197 ACACCACTTATATTTAACATAGG - Intergenic
1120180176 14:81335168-81335190 CCAACTCTTAGATTTAAAATTGG - Intronic
1127041917 15:54986580-54986602 CTACCGCTTAGATTTAACCAAGG + Intergenic
1127289268 15:57555577-57555599 CCACCACCAAGAATTAACAGTGG + Intergenic
1127676204 15:61241757-61241779 GCACCCCTGAGATTGAAAAGTGG - Intergenic
1138016676 16:53434678-53434700 CCACCCCTCAGATCCAGCAGCGG + Exonic
1153284995 18:3449299-3449321 TCACCCCTTAGCTATAAAAGTGG + Intronic
1155307536 18:24493234-24493256 CCACCACCTAGATTCAACAATGG + Intergenic
1162241481 19:9358325-9358347 CCAGTCTTTAGAGTTAACAGAGG + Intronic
926043952 2:9695907-9695929 CCATCCCTTAGAGACAACAGGGG - Intergenic
928906436 2:36373163-36373185 CCACACCCTCGATTTAACTGTGG - Intronic
930800684 2:55439595-55439617 CCATGACTTAGCTTTAACAGTGG + Intergenic
935381166 2:102452419-102452441 ACACCCCTAAGATTTCCCAGTGG + Exonic
936474548 2:112828467-112828489 CCACGCGTAATATTTAACAGTGG + Intergenic
939313363 2:140513734-140513756 CAACCCCTGAAATTTAAAAGAGG + Intronic
943936926 2:193931083-193931105 CGAACCCTTATATTTAACACTGG + Intergenic
947583948 2:231340424-231340446 CCACCCCTTAACTGTAACTGGGG + Intronic
1174649168 20:52110251-52110273 CAACCCCTTATATTTCACAAAGG + Intronic
1180593104 22:16957139-16957161 CCACCCTTTAGAGTTAAGGGTGG + Intergenic
949834673 3:8255004-8255026 CCACCCCTTAGAGTGGACACTGG + Intergenic
950571172 3:13800965-13800987 CCAGCCCCTGCATTTAACAGTGG - Intergenic
950759176 3:15205902-15205924 CCATCCCTTACACTTAACAGAGG + Intergenic
952844340 3:37674548-37674570 ACACCCCTCAGATTCAACAAGGG + Intronic
956564766 3:70624117-70624139 CCACCCCCTACATTTTAGAGTGG - Intergenic
956598184 3:70991688-70991710 ACACTCCTTTGATTTAACAGAGG + Intronic
961122464 3:124384617-124384639 CCACCCCTGGGATTTCTCAGAGG - Intronic
963526604 3:146422960-146422982 CCACCCTTTAGATAAATCAGAGG + Intronic
970570328 4:17374807-17374829 CCACTTCTTTTATTTAACAGAGG - Intergenic
987017038 5:13831195-13831217 CCAACTCTTAGATTCAAAAGGGG - Intronic
989068635 5:37488160-37488182 ACACCCATCAGACTTAACAGTGG - Intronic
992568447 5:78026090-78026112 CAACCCCTTTGATTAAACAGGGG + Intronic
993050120 5:82916820-82916842 CCACCACTTAGCTATAACTGTGG + Intergenic
1003754070 6:9096315-9096337 CCAACCCTAAGATTTAGAAGTGG - Intergenic
1004135797 6:12965196-12965218 CCCCCCCATGGATTGAACAGAGG + Intronic
1004750682 6:18558781-18558803 TCCACCCTTAGATTTAATAGAGG + Intergenic
1005401481 6:25438799-25438821 CCACCCCTAAAATGTTACAGTGG - Intronic
1009313883 6:62193235-62193257 GTACACCTTAAATTTAACAGAGG - Intronic
1009388638 6:63118356-63118378 CCAACCCATACATTTTACAGAGG - Intergenic
1014789441 6:125655510-125655532 CCACCCCTTTCATTTTACAGAGG - Intergenic
1016477584 6:144444840-144444862 TCACACCTTTGATTTAACACTGG + Intronic
1021231943 7:18095513-18095535 CCACCACTTAGATGGAAAAGAGG + Intronic
1021525417 7:21580906-21580928 CCAGCCCTGACATTTACCAGTGG + Intronic
1021582939 7:22176411-22176433 CCAATCCTTAGTCTTAACAGAGG - Intronic
1022790861 7:33687744-33687766 CCACCCAGTATGTTTAACAGAGG + Intergenic
1023264326 7:38390557-38390579 CCACCCCTGAGAGTAAACATTGG + Intronic
1024280751 7:47717374-47717396 CCTGACCTTGGATTTAACAGTGG + Intronic
1042864111 8:73342125-73342147 CCACCACCCAGATTCAACAGTGG + Intergenic
1044340844 8:91044759-91044781 CAACCCCCAACATTTAACAGTGG + Intergenic
1052296655 9:26903811-26903833 CCACCCCTTACATTTTGAAGAGG + Intergenic
1056374864 9:85997782-85997804 CCTCACCTTAGTTTTAAGAGTGG + Intronic
1058141893 9:101365434-101365456 CTACCCTGTATATTTAACAGGGG + Intronic
1187490213 X:19744373-19744395 CTACCCCTTATAATAAACAGCGG - Intronic
1194262683 X:91716657-91716679 CCACCCCTTATCCTTCACAGTGG + Intergenic
1194735308 X:97506014-97506036 CCACCTCATAGCTTTAACAGTGG + Intronic
1198126923 X:133653991-133654013 CTAACCCTTTGATTTTACAGAGG - Intronic
1198786914 X:140298699-140298721 CCACCCCTTTTATCTAACACTGG + Intergenic
1199303491 X:146240164-146240186 CCAGCCCTTATAACTAACAGTGG + Intergenic