ID: 1113881388

View in Genome Browser
Species Human (GRCh38)
Location 13:113628707-113628729
Sequence CTGGGCCCCTAGGGAAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 207}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113881388_1113881393 -3 Left 1113881388 13:113628707-113628729 CCTTTTTTTCCCTAGGGGCCCAG 0: 1
1: 0
2: 0
3: 14
4: 207
Right 1113881393 13:113628727-113628749 CAGCTCTGAACTATCCTTCCCGG 0: 1
1: 0
2: 1
3: 15
4: 167
1113881388_1113881397 19 Left 1113881388 13:113628707-113628729 CCTTTTTTTCCCTAGGGGCCCAG 0: 1
1: 0
2: 0
3: 14
4: 207
Right 1113881397 13:113628749-113628771 GCACTGTCCCATCCACCCTTTGG 0: 1
1: 0
2: 3
3: 15
4: 127
1113881388_1113881400 30 Left 1113881388 13:113628707-113628729 CCTTTTTTTCCCTAGGGGCCCAG 0: 1
1: 0
2: 0
3: 14
4: 207
Right 1113881400 13:113628760-113628782 TCCACCCTTTGGCACCTCCTTGG 0: 1
1: 0
2: 0
3: 9
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113881388 Original CRISPR CTGGGCCCCTAGGGAAAAAA AGG (reversed) Intronic
901828787 1:11879671-11879693 CTGGGCCCCTGGAGGAAGAACGG + Intergenic
902873382 1:19327097-19327119 CTGGGCACCCAGGGAAAGATTGG + Intronic
903142968 1:21350703-21350725 CTGGGCCCCTGGTGAAAGACTGG + Intergenic
904691925 1:32299594-32299616 CTAGGCACCCAGTGAAAAAAAGG - Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
908113765 1:60921829-60921851 CTGAGACCCTGGGGAAACAATGG - Intronic
911870286 1:103088707-103088729 CTGAGTCCCTAGGGATAAATAGG + Intronic
912036602 1:105324565-105324587 CTTGGGCCTTAAGGAAAAAATGG - Intergenic
914050372 1:144125929-144125951 CTGGGTCCAGAGGGAAAAACTGG - Intergenic
914128810 1:144839516-144839538 CTGGGTCCAGAGGGAAAAACTGG + Intergenic
915790377 1:158663255-158663277 CTGGGCCTCAAGGAAAAAACTGG + Intronic
916684546 1:167132661-167132683 CTGGGCCCCTAGAGACACAGAGG + Intergenic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
920983638 1:210863068-210863090 CTTATCCCCTATGGAAAAAAAGG + Intronic
921077158 1:211709077-211709099 CTGGACCCCTTGGGAAAAGCAGG + Intergenic
921699708 1:218254456-218254478 CAGAGCCCCTGGGGAATAAAAGG + Intergenic
924038281 1:239957773-239957795 CTGAGCCCTGAGGGAACAAAGGG + Intergenic
924903403 1:248426496-248426518 CAGGGCCCCTCTGGAATAAAGGG - Intergenic
1069485995 10:68823942-68823964 CTGACCCTTTAGGGAAAAAATGG + Intergenic
1072085795 10:92077882-92077904 CTGGTCCCTGAGGGGAAAAAGGG + Intronic
1072152078 10:92691320-92691342 CTGGAGCCCTAGGGTAAATAAGG + Intronic
1076256684 10:129032110-129032132 ATGCTCCCCTAGGGAAGAAAAGG + Intergenic
1077283301 11:1755021-1755043 CTGGGTCCCTAGGAGGAAAAGGG + Exonic
1082767244 11:57179852-57179874 CTGGCCCTCGAGGAAAAAAAAGG + Intergenic
1083150786 11:60790587-60790609 GGGGGCCCCAAGGGAAGAAAGGG + Intronic
1085510194 11:77084245-77084267 CTGGGCCCCTGGGGAATGGAGGG + Intronic
1087227061 11:95613278-95613300 CTGGTCTCCTTGGGAAAAACAGG - Intergenic
1089328892 11:117676509-117676531 CTGGACCCTTTGGGAAAAAGAGG - Intronic
1089354810 11:117842627-117842649 CTGGGCCCCTTGGGACATTAGGG - Intronic
1090074943 11:123574492-123574514 CTGGGGCCCTGGGGAAGGAAGGG + Intronic
1090401228 11:126449535-126449557 ATGGGCCCCTTTGGAAAAGAAGG + Intronic
1093856977 12:24116620-24116642 CTGTGTGCTTAGGGAAAAAAAGG - Intergenic
1094480121 12:30874943-30874965 ATGTGCCCCTGGGGACAAAAAGG - Intergenic
1096790179 12:54039534-54039556 CTGGGATCCTAGGAAAATAAAGG - Intronic
1096877402 12:54640980-54641002 CTGGGCCCAGAGGAAAAAAAGGG + Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098121385 12:67243737-67243759 CTTGGCCCCTCCGGAAAAAAGGG - Intergenic
1099083965 12:78221999-78222021 CTAGGGCCCTAGAGAAAAACTGG - Intergenic
1100079352 12:90828751-90828773 CTGGGGCAATAGGGATAAAATGG - Intergenic
1101596475 12:106169959-106169981 CTGGTCCACTTGGAAAAAAAAGG - Intergenic
1102796823 12:115696124-115696146 CTGGAGCCCTAGGGAAACCAGGG + Intergenic
1103720759 12:122974180-122974202 CTGGGCCTCCTGGGGAAAAAGGG + Intronic
1103758733 12:123232766-123232788 CGGGGCACCTTGGCAAAAAATGG + Intronic
1104752361 12:131247770-131247792 CTGGGCTCCTGGGTTAAAAACGG + Intergenic
1104779574 12:131411458-131411480 CTGGGCTCCTGGGTTAAAAACGG - Intergenic
1105124587 13:16838150-16838172 CTTGACCCCTACGGAGAAAAGGG + Intergenic
1105585541 13:21739487-21739509 ATGTGGCCCTAGGGATAAAATGG - Intergenic
1108750657 13:53445106-53445128 CTGGGAGCCAAGGGAATAAAAGG - Intergenic
1111031859 13:82610850-82610872 CTAGGCCCCTAGGGTCATAAAGG - Intergenic
1113879237 13:113614457-113614479 CTGGGCTCCCAGGGCACAAACGG - Intronic
1113881388 13:113628707-113628729 CTGGGCCCCTAGGGAAAAAAAGG - Intronic
1116763006 14:49038209-49038231 CTGGATCCCTAGGGAAAGACTGG + Intergenic
1117638213 14:57769699-57769721 CAGGGCCCCTATGGAAAGTATGG + Intronic
1120106778 14:80505013-80505035 CTGTCACCCTAAGGAAAAAAAGG + Exonic
1121429769 14:93878631-93878653 CTGGGTCCCTGGGGAAAAACAGG + Intergenic
1123420244 15:20125238-20125260 CTGGGTCCAGAGGGAAAAACTGG - Intergenic
1123529468 15:21131774-21131796 CTGGGTCCAGAGGGAAAAACTGG - Intergenic
1124115740 15:26842073-26842095 CTGGGATCCTAGGAAAAAGAAGG + Intronic
1124406546 15:29397793-29397815 CTGAGCACAGAGGGAAAAAAGGG + Intronic
1128564302 15:68690239-68690261 CTGGGTCTCCAGAGAAAAAAAGG - Intronic
1128816449 15:70612944-70612966 CTCTGCCCTTAGGGGAAAAAAGG - Intergenic
1129122999 15:73414324-73414346 CTGGGACCCTGGGGAAAAGGAGG - Intergenic
1130865670 15:87931280-87931302 TTGGGCCCCAGGGGAACAAAAGG + Intronic
1131622091 15:94079123-94079145 CTGGGAGCCTAGAGAAAAAGGGG + Intergenic
1134045039 16:11094647-11094669 CAGGGCCCCACAGGAAAAAAGGG - Intronic
1135085783 16:19473504-19473526 CTGGGCATCTTGGTAAAAAAGGG + Intronic
1135487628 16:22879812-22879834 CTGGGCCCCCAGAGAAGATAAGG + Intronic
1135991448 16:27221151-27221173 CTGTGCCCATATGGAAAAGAGGG + Intronic
1136721130 16:32320312-32320334 CTGGGTCCAGAGGGAAAAACTGG - Intergenic
1136839512 16:33526598-33526620 CTGGGTCCAGAGGGAAAAACTGG - Intergenic
1137722993 16:50638805-50638827 CGGGGACCCTGGGGAGAAAATGG + Exonic
1140120834 16:72081866-72081888 TTGGGTCCTGAGGGAAAAAAGGG - Intronic
1203005302 16_KI270728v1_random:197458-197480 CTGGGTCCAGAGGGAAAAACTGG + Intergenic
1203136852 16_KI270728v1_random:1733579-1733601 CTGGGTCCAGAGGGAAAAACTGG + Intergenic
1203149678 16_KI270728v1_random:1826883-1826905 CTGGGTCCAGAGGGAAAAACTGG - Intergenic
1144515181 17:15912477-15912499 CAGAGGCCCTAGGGAGAAAAAGG - Intergenic
1144642456 17:16945067-16945089 CTGGGCCCCTGGAGAAATAAAGG + Intronic
1145206627 17:20987886-20987908 CTGGGCCCCTGGAGAAACACAGG - Intergenic
1145233860 17:21194889-21194911 CTGGGCCCTGAGGGAAGGAAGGG - Intergenic
1146182621 17:30707737-30707759 CTGGGCCCCAAGCCAAAAATAGG - Intergenic
1151552513 17:74830234-74830256 CTGGGGGCCTGGGGAAAGAAGGG - Intronic
1152125017 17:78441397-78441419 CGGGGCCCCTCGGGAAAGAAAGG - Intronic
1152139075 17:78525788-78525810 CCGGGGCCCTAGGGAGAGAATGG + Intronic
1152376110 17:79919829-79919851 CTGGGCCCCTAGAGTAGAAAGGG + Intergenic
1153018933 18:609415-609437 CGTGTCCCCAAGGGAAAAAAAGG - Intronic
1155142552 18:23056063-23056085 CTGGGGCCCTACAGTAAAAAAGG + Intergenic
1155673612 18:28402621-28402643 CAGGGGCCCTAGGGGCAAAATGG + Intergenic
1155696274 18:28690711-28690733 ATGGGCCCCTTGAGCAAAAATGG + Intergenic
1155940595 18:31798748-31798770 CTGTGAACCTAGGGGAAAAAAGG + Intergenic
1160227174 18:77020214-77020236 CTGGGACACTAAGGAAAGAAAGG + Intronic
1162322615 19:9978942-9978964 CAGGACCCCTTGGGAAAGAAGGG - Exonic
1162453384 19:10768051-10768073 CTGACCCACTAGGGAAGAAACGG + Intronic
1162957458 19:14107208-14107230 ATGGGCACCTAGGGAGCAAATGG + Intronic
1162976200 19:14208069-14208091 CTGGGCCCCAAGCCAAAAATAGG + Intergenic
1164194682 19:22945816-22945838 CTGGGACCCAGAGGAAAAAAAGG + Intergenic
1165209329 19:34220868-34220890 CTCAGCCCCAAGGGAAAAGAAGG - Intronic
1165424562 19:35738742-35738764 CTGGGCCCCCAGGGCAGAAAGGG - Exonic
1166523458 19:43496370-43496392 GTGAGACCCTTGGGAAAAAATGG - Intronic
1166857717 19:45791609-45791631 CGGAGCCCCTAGGTAATAAATGG - Intronic
1167077493 19:47258307-47258329 CTGGGGACAGAGGGAAAAAAAGG - Intronic
1167333252 19:48869078-48869100 CAGGTCCCCTAGGGAGAAAAGGG + Intergenic
1167399572 19:49255890-49255912 GTGGGCTCCTAGGGGAAAATGGG - Intergenic
1167514169 19:49913366-49913388 CTGGGGCCCCAGGTAAACAAAGG - Intronic
1167812695 19:51848315-51848337 CTGGGTCCCTAGGGGAAAGAAGG + Intergenic
1202689779 1_KI270712v1_random:78567-78589 CTGGGTCCAGAGGGAAAAACTGG - Intergenic
925736089 2:6965237-6965259 CTGGGCCTGGAGGGAAAATAGGG + Intronic
928224738 2:29438906-29438928 CTGGAGCCCTAGGGAAGAACTGG - Intronic
929954724 2:46447933-46447955 CTGGGCAACCAGGGAAAAAAAGG - Intronic
931205194 2:60139922-60139944 CTGGACCCCAAGGGAAAACAGGG + Intergenic
933956642 2:87377455-87377477 CTGGGTCCAGAGGGAAAAACTGG + Intergenic
934240784 2:90269482-90269504 CTGGGTCCAGAGGGAAAAACTGG + Intergenic
934272408 2:91547277-91547299 CTGGGTCCAGAGGGAAAAACTGG - Intergenic
936148450 2:109997188-109997210 CTGGGTCCAGAGGGAAAAAGTGG - Intergenic
936196227 2:110374180-110374202 CTGGGTCCAGAGGGAAAAAGTGG + Intergenic
940839164 2:158559344-158559366 CTGGGTCCCTTTGGAAAGAAAGG - Intronic
941044141 2:160653438-160653460 CTGGCCCTATAGGGAGAAAAAGG + Intergenic
944396760 2:199276756-199276778 CTGGGCCCATTTTGAAAAAAGGG - Intronic
946270391 2:218587571-218587593 CAGGGCCCCTAAAGAAAATAAGG - Exonic
947141983 2:227027918-227027940 CTGGACCTCCAGGGAGAAAAGGG - Exonic
947373078 2:229468252-229468274 CTGGTTCCCTAGGCAAGAAAGGG - Intronic
947811645 2:233008328-233008350 CTGGGCCCAAAGTGAAAAGATGG - Intronic
1172442113 20:34973161-34973183 CTGGGCCACTGGGGCATAAAGGG - Intergenic
1175780834 20:61680907-61680929 CTGTGTCTCTAGGGAAGAAATGG - Intronic
1176061207 20:63173733-63173755 ATTGGCCCCTGGGGAACAAAAGG + Intergenic
1178961045 21:37065252-37065274 CTGGGCCCCTCAGGACAAACAGG + Exonic
1180154728 21:45972425-45972447 CTGGGGCAGTAGGGAAGAAAGGG - Intergenic
1180551641 22:16545996-16546018 CTGGGTCCAGAGGGAAAAACTGG + Intergenic
1181352361 22:22267927-22267949 CTGGGTCCAGAGGGAAAAACTGG - Intergenic
1181808485 22:25389770-25389792 CTGGCGCCTTAGGAAAAAAACGG - Intronic
1182127990 22:27830102-27830124 CTGGGCCCCAAAGGAAAATCTGG + Intergenic
1182372148 22:29818907-29818929 CTGGGCTGCTGGGGAAGAAAAGG - Intronic
1183322851 22:37175784-37175806 CTGAGACCCCAGGGAAGAAATGG + Intergenic
1183724087 22:39578808-39578830 CTGGACCCCAAGGGAAAGAACGG - Intronic
1185045948 22:48528845-48528867 CTGGGCCCCAAGGAAAGCAAAGG - Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
950677240 3:14561724-14561746 CTTGGCCCGTGGGGAAGAAAAGG - Intergenic
951465020 3:22991414-22991436 CTGGCCCCCCAGGGAAAACCGGG - Intergenic
953184782 3:40627957-40627979 CTGGGAACCTCGGGAGAAAAAGG - Intergenic
954304310 3:49717445-49717467 GTGGGCCCACAGGGAAAAGAAGG - Exonic
955500518 3:59578438-59578460 GTGGACCCCTAGGAAAAACATGG - Intergenic
955979133 3:64507195-64507217 CTGGCACCCCAGGGAAGAAATGG + Intergenic
960266696 3:115628236-115628258 CTGGGGCTCTGGGGAAAACACGG - Intronic
965214511 3:165844650-165844672 TTGGGCTTCAAGGGAAAAAATGG + Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
966715879 3:183012515-183012537 CTGGGCCACTAGGCAGAGAAGGG - Intergenic
966950378 3:184812015-184812037 CTTCCCCCCTACGGAAAAAATGG - Intergenic
967543560 3:190696960-190696982 CTGGGTCACTAGGGAAAAACCGG - Intergenic
968276361 3:197443448-197443470 CTGGGGCCCCAGGAGAAAAAAGG + Intergenic
968932230 4:3587235-3587257 CAGGGCCCCTCGGAAACAAAGGG + Intronic
969556765 4:7916831-7916853 CTGGGCCCCTAGTGCAAGGAGGG - Intronic
970069612 4:12142707-12142729 CTGGACACACAGGGAAAAAATGG + Intergenic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
975075177 4:70198072-70198094 CTGGGCTCCTTGGGCAAAACTGG - Exonic
977177419 4:93834434-93834456 CTAGGCCCCTAAGGAGAAAGGGG + Intergenic
977287643 4:95129008-95129030 CTGGGCTCACAGGGAAATAAAGG - Intronic
977997890 4:103517014-103517036 TTGGGACCCTAGAGAAAAGATGG + Intergenic
981822943 4:148906953-148906975 CTTGGCCACCAGGGGAAAAAGGG - Intergenic
985034700 4:185826643-185826665 CTGGGTCAGTAGGAAAAAAATGG + Intronic
986029264 5:3880338-3880360 CTGAGCCCCAAGAGAAAGAATGG + Intergenic
987218994 5:15770228-15770250 CTGGGGCCCTACGGAAAATCAGG - Intronic
988216983 5:28287514-28287536 CTGGGCCAGTAGGAAAAGAAGGG - Intergenic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
990738379 5:58888351-58888373 CTGAGCCCAAAAGGAAAAAAGGG - Intergenic
990842480 5:60098762-60098784 CAGGGCCACTAGGCAAGAAATGG - Intronic
991005874 5:61827652-61827674 CTAGCTCCCTAGTGAAAAAATGG - Intergenic
992701942 5:79349635-79349657 CAGGGCCCTTAGGGAAAATTTGG + Intergenic
994297599 5:98109737-98109759 CTGGAGCACTAGGGAAAAAGTGG - Intergenic
997361255 5:133296541-133296563 CTAGCCCCCTAGGTAAAAATAGG - Intronic
997441336 5:133910825-133910847 CTGGGCCCTTTGGGAAAAGTTGG + Intergenic
997975770 5:138440520-138440542 CTGGGGCCCTAGGGAACAGAGGG - Intronic
1001484682 5:172111142-172111164 CTGGGCCTCCAGGGTAAGAATGG + Intronic
1004352576 6:14903139-14903161 CTGGGCCCCTGAGATAAAAAGGG - Intergenic
1004571155 6:16846610-16846632 CTTCTGCCCTAGGGAAAAAATGG - Intergenic
1005737867 6:28765676-28765698 CTACCCCCCTAGGGACAAAAAGG - Intergenic
1006883134 6:37356690-37356712 TTCTGCCCCAAGGGAAAAAAGGG + Intronic
1008910357 6:56725535-56725557 CTGGGCCCCTGGGTAGAAGAGGG + Intronic
1011172569 6:84522201-84522223 ATGGGCCCCTTGGGGAAGAAGGG + Intergenic
1011502482 6:88006541-88006563 CTGGGCCCCTTGAGAAGAGAAGG - Intergenic
1013463517 6:110398335-110398357 CTGTGCCCCTGAGGAAAATAAGG + Intronic
1013618896 6:111870731-111870753 CTGGGCCCCAAAGGTTAAAAAGG + Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1016989939 6:149922105-149922127 CTGGGCCCCAAGGGCAGAAGTGG + Intronic
1016993114 6:149942958-149942980 CTGGGCCCCAAGGGCAGAAGTGG - Intronic
1017005222 6:150024566-150024588 CTGGGCCCCAAGGGCAGAAGTGG + Intronic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018522714 6:164669086-164669108 CTGTGGCCCTGGGGAAACAAAGG - Intergenic
1020197943 7:6056654-6056676 CTGGGCCTCTTTGGAAGAAAAGG + Intronic
1022108127 7:27211182-27211204 CTGCTCCCCTAGGGAGAAAGGGG + Intergenic
1023192427 7:37597085-37597107 CTGGGCCCCTAGAGGATGAAAGG + Intergenic
1023588597 7:41757621-41757643 CTGAGCTCCTTGGGAAAAACAGG - Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1027689416 7:81324094-81324116 CTGGGCCCATAGGAAGAAATGGG + Intergenic
1028978560 7:96941261-96941283 CTGTGCCCCCAGGGAAAATGGGG + Intergenic
1028995013 7:97090665-97090687 CTGGGCCCATGAGGGAAAAAGGG - Intergenic
1031454951 7:121967936-121967958 CAGTGCTCCTAGGGAAAAGAAGG - Exonic
1032345040 7:131109550-131109572 CTGAGCCCCCAGGCAGAAAAGGG - Intergenic
1033249669 7:139747747-139747769 ATGGGACCCAAGGGAAAAACCGG - Intronic
1034507141 7:151501848-151501870 CTGGGCCCTTAGGGAAGAGGAGG + Intronic
1039898127 8:41730772-41730794 CTGGGCTCCCATGGAAAAGAAGG + Intronic
1040129026 8:43772722-43772744 CTGGGGCCTATGGGAAAAAATGG + Intergenic
1044221476 8:89675020-89675042 CTGGGCACATAAGGAAATAAAGG + Intergenic
1044931304 8:97254202-97254224 GTGGGACCCTAGGGACAACAGGG + Intergenic
1048928618 8:139292770-139292792 CTGGGACCCCAAGGATAAAAAGG + Intergenic
1049951889 9:653114-653136 CTGGGCCCAAAGGGAACACAAGG - Intronic
1052173270 9:25427494-25427516 CTGGGGCCCCAGGGAAAGACAGG - Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052918837 9:33946532-33946554 CTGGCCCCATAGAGAAAAAGAGG - Intronic
1053281181 9:36820604-36820626 CAGGGCCTCTCGGGAGAAAATGG + Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1057298614 9:93863589-93863611 CTGGGAAGCTAGGGAAAAGAGGG + Intergenic
1060190245 9:121588167-121588189 CTGGCTGCATAGGGAAAAAAAGG + Intronic
1060833197 9:126732864-126732886 ATGGTCCCCTAAGAAAAAAAGGG + Intergenic
1060959063 9:127666150-127666172 CTGGGCCCTGGGGGAAAACAGGG - Exonic
1060976495 9:127768096-127768118 CTGGGCCCCTTCGGAAGACAAGG + Intronic
1187882453 X:23859838-23859860 CTGCTCTCTTAGGGAAAAAAAGG - Intronic
1188048190 X:25452151-25452173 CTGGTGACCTGGGGAAAAAAAGG + Intergenic
1189197786 X:39166498-39166520 CTGGGCCCTTGGAGAAAGAAGGG + Intergenic
1190375510 X:49784949-49784971 CAGGGCCCCTAAGCAAATAAAGG - Intergenic
1191933860 X:66405028-66405050 CTGTGCCCCTAGGGAACCGAAGG + Intergenic
1197778826 X:130139586-130139608 TTAAGCTCCTAGGGAAAAAATGG - Intronic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic