ID: 1113882348

View in Genome Browser
Species Human (GRCh38)
Location 13:113634448-113634470
Sequence CTGTGAGGATGTGAGGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 522
Summary {0: 1, 1: 2, 2: 7, 3: 72, 4: 440}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113882342_1113882348 12 Left 1113882342 13:113634413-113634435 CCCTTCGATTACATTCTGGGTAA 0: 1
1: 0
2: 0
3: 11
4: 171
Right 1113882348 13:113634448-113634470 CTGTGAGGATGTGAGGATGTGGG 0: 1
1: 2
2: 7
3: 72
4: 440
1113882343_1113882348 11 Left 1113882343 13:113634414-113634436 CCTTCGATTACATTCTGGGTAAA 0: 1
1: 0
2: 0
3: 8
4: 152
Right 1113882348 13:113634448-113634470 CTGTGAGGATGTGAGGATGTGGG 0: 1
1: 2
2: 7
3: 72
4: 440
1113882339_1113882348 18 Left 1113882339 13:113634407-113634429 CCATATCCCTTCGATTACATTCT 0: 1
1: 0
2: 0
3: 6
4: 175
Right 1113882348 13:113634448-113634470 CTGTGAGGATGTGAGGATGTGGG 0: 1
1: 2
2: 7
3: 72
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113882348 Original CRISPR CTGTGAGGATGTGAGGATGT GGG Intronic
901069742 1:6511255-6511277 CTGTGGGGAGGGGAGGGTGTTGG - Intronic
901465234 1:9417128-9417150 GTGTGAGCATGTGAAGATGGAGG - Intergenic
902334349 1:15746618-15746640 CTGCGAGGCTGCGAGGCTGTGGG + Intronic
902538574 1:17136306-17136328 GTGTGAGGATGGGTGGATGCAGG - Intergenic
903036713 1:20497847-20497869 TTGTGAGGACGTGTGGATGTAGG + Intergenic
903337948 1:22637370-22637392 GTGTGAGTGTGTGAAGATGTGGG + Intronic
903450677 1:23451869-23451891 CCATGAGGATGGGAGGATGAAGG + Intronic
903864578 1:26388952-26388974 CTGTGTGGGGGTGTGGATGTGGG - Intergenic
904260402 1:29284474-29284496 CTGGGAGGATCTGAGAAAGTGGG + Intronic
905893114 1:41529322-41529344 ATGTGTGAATGTGAGGGTGTGGG - Intronic
907561773 1:55397531-55397553 CTATGTGTATGTGAGGGTGTTGG - Intergenic
907990423 1:59577117-59577139 CTGGGAGGAGGTAAGGATGGCGG - Intronic
908742450 1:67342627-67342649 GTGTGAGGATGTGAGGATGTTGG + Intronic
910166107 1:84329048-84329070 CAGTGAGGATATTAGGAGGTGGG + Intronic
910362755 1:86430562-86430584 CTGGGGAGATGAGAGGATGTGGG + Intronic
910486274 1:87717898-87717920 TGGTGAGGATGTGAGGTTTTGGG - Intergenic
910843175 1:91580730-91580752 TGGTGAGGATGTGAGGAAATTGG + Intergenic
911540816 1:99156308-99156330 CTGTCAGGGTGTGGGGAGGTAGG - Intergenic
911848524 1:102784600-102784622 CTCAGAAGATGGGAGGATGTGGG - Intergenic
912345596 1:108960745-108960767 CTGTGAGGAGGTTAGGATGGGGG + Intronic
912353097 1:109033488-109033510 GTGTGTGGAAGTGAGCATGTTGG - Intronic
913290868 1:117270344-117270366 CAGTGAGCATGTTAGGATGCAGG + Intergenic
913565713 1:120070025-120070047 GTGTGTGGATGTGTGGGTGTAGG - Intergenic
913632416 1:120723529-120723551 GTGTGTGGATGTGTGGGTGTAGG + Intergenic
914286305 1:146229399-146229421 GTGTGTGGATGTGTGGGTGTAGG - Intergenic
914386575 1:147175003-147175025 AAGTGAGGATGTGAGAATGAAGG + Intergenic
914547337 1:148680141-148680163 GTGTGTGGATGTGTGGGTGTAGG - Intergenic
914619178 1:149390219-149390241 GTGTGTGGATGTGTGGGTGTAGG + Intergenic
915659270 1:157388834-157388856 CTGTGAGGAAGTGTGGATCAGGG + Intergenic
915780055 1:158538257-158538279 CAGTGAGGATGTGGGGAAATTGG - Intergenic
916006355 1:160664792-160664814 CAGTGATGATGTGAAGGTGTGGG - Intergenic
916759576 1:167804151-167804173 AGGTGAGGTTGTGAGTATGTAGG - Intergenic
918493216 1:185105317-185105339 CTGTGAGGAAGTCCAGATGTTGG + Intergenic
919253139 1:195085179-195085201 GTGTGAGTAGGTGTGGATGTGGG - Intergenic
919935307 1:202246899-202246921 AGATGAGGAAGTGAGGATGTAGG + Intronic
920541187 1:206779282-206779304 AGGTGAGGGCGTGAGGATGTGGG - Intergenic
922218221 1:223538244-223538266 CTGTGAGGATGTCTGGAGGGGGG - Intronic
922457927 1:225791676-225791698 AGGTGAGGGCGTGAGGATGTGGG + Intergenic
922571462 1:226636999-226637021 CTGTGAAGGTGTGTGCATGTAGG + Intronic
922922618 1:229319554-229319576 CTGTGAACATGTGAGTAGGTGGG + Intergenic
1063142619 10:3268770-3268792 CTGTGATGGTGTTAGGAGGTGGG - Intergenic
1063499563 10:6540862-6540884 TGGTGAGGCTGTGAAGATGTGGG - Intronic
1063663296 10:8048240-8048262 CTGGGTGGCTGTGAGGATGTGGG + Intergenic
1063969026 10:11368315-11368337 AAGTGAGGAAGTGAGGAAGTAGG - Intergenic
1065835349 10:29652691-29652713 TTGTGAGGATGTGAAGAAATTGG - Intronic
1066564745 10:36709892-36709914 GTGGGAGGATGAGAGGATGAGGG - Intergenic
1067432702 10:46254413-46254435 CTGTGAGGAGGACAGGATGCAGG - Intergenic
1067440566 10:46307070-46307092 CTGTGAGGAAGGCAGGATGCAGG + Intronic
1067576792 10:47414157-47414179 CTGTGAGGAGGGCAGGATGCAGG + Intergenic
1068595330 10:58896786-58896808 GTGTGTGCATGTGTGGATGTGGG - Intergenic
1068940758 10:62678590-62678612 CTGAGAGGGTGTGAGGAGCTTGG - Intergenic
1070781777 10:79141815-79141837 CTGGGAGGATGTCAGGATAGGGG + Intronic
1071058756 10:81544768-81544790 TGGTGAGGATGTGAAGAAGTTGG + Intergenic
1075479029 10:122763518-122763540 TGGTGAGGACGTGCGGATGTGGG + Intergenic
1076138314 10:128060121-128060143 CTGTGTGAATGTGTGCATGTGGG - Intronic
1076206937 10:128611169-128611191 CTGTAGTGATGTGAGGATCTTGG + Intergenic
1076465083 10:130674654-130674676 ATGTGAGGATGTGAAGAAATGGG - Intergenic
1076601180 10:131657996-131658018 GTGTTGGGAGGTGAGGATGTGGG + Intergenic
1076828218 10:132981133-132981155 GTGTGAGTGTGTGAGGATCTGGG + Intergenic
1076940521 10:133603950-133603972 TGGTGAGGATGTGCAGATGTGGG - Intergenic
1076941128 10:133609764-133609786 TGGTGAGGACGTGCGGATGTGGG - Intergenic
1078433773 11:11308029-11308051 CTGGGAGGATTGGAGGAAGTGGG - Intronic
1078561973 11:12380103-12380125 CTGTGAGGAATAGAGGATGTTGG - Intronic
1078609585 11:12808886-12808908 CTGTGAGAATGTGAGAATACAGG + Intronic
1078961452 11:16277323-16277345 ATGTGAGGATGCCAGGATGCAGG + Intronic
1079963830 11:26956172-26956194 ATTTTAGGAGGTGAGGATGTTGG - Intergenic
1081713640 11:45233686-45233708 CTGTCAGGAGGAGAGGATGTGGG + Intronic
1083325873 11:61872767-61872789 CTGTCAGGCTGTGTGGATGCTGG + Intergenic
1083354317 11:62054471-62054493 CTCTGAGCTTGTCAGGATGTAGG - Intergenic
1083427117 11:62593906-62593928 CTGGCAGGATGTGAGGGTGCAGG + Exonic
1084199219 11:67544102-67544124 CTGTGAGTATCTGTGCATGTGGG + Intergenic
1084911185 11:72390678-72390700 TGGTGAAGATGTGAGGATCTGGG + Intronic
1085117107 11:73939068-73939090 TGGTGAGGACGTGAGGATGTGGG + Intergenic
1085779351 11:79394282-79394304 CTGTGGGGATGTGAGGAGGGTGG + Intronic
1086291046 11:85309627-85309649 CAGGGAGGATGTCAGGTTGTGGG - Intronic
1086621382 11:88890118-88890140 GGGTGGGGATGTGGGGATGTGGG - Intronic
1088085607 11:105975398-105975420 ATGAGAGGATGTGAGTAAGTGGG - Intronic
1088588103 11:111377769-111377791 CTGTGTGGATGAGAGCAGGTGGG - Intronic
1088818021 11:113434606-113434628 GTGTGGGGATGTGGGGAGGTGGG + Intronic
1088965135 11:114712624-114712646 TTGTGAGGATGTGAAGAAGTTGG + Intergenic
1089387765 11:118079316-118079338 CTGTGGGGATGGAAGGAGGTAGG - Intronic
1089851438 11:121500254-121500276 TTATGAGGTTGTGAGGTTGTAGG - Intronic
1090551719 11:127827014-127827036 CTATGAGAAGCTGAGGATGTGGG + Intergenic
1090688917 11:129156622-129156644 CTGTGAGAAGGTGGGGCTGTGGG + Intronic
1090742823 11:129681768-129681790 ATGTGATGGTGTTAGGATGTAGG + Intergenic
1091196828 11:133738711-133738733 GTGTGAGGGTGTGTGTATGTGGG + Intergenic
1091326951 11:134698370-134698392 CTGTGAGGAGGTGAGGCAGCTGG - Intergenic
1091541397 12:1465856-1465878 CTGTGAGAATGTGCTGATGCTGG + Intronic
1093287438 12:17281997-17282019 CTATGAGGATGCAAAGATGTAGG - Intergenic
1093763066 12:22932117-22932139 ATGTGATGGTGTGAGGAGGTGGG + Intergenic
1094167726 12:27459755-27459777 ATGTGAGGATGTGAGTGTGATGG - Intergenic
1094316355 12:29140244-29140266 GTCTGAGGATCTGAGGTTGTAGG + Intergenic
1094802050 12:34048422-34048444 AGGTGAGGACGTGAGGATGTGGG - Intergenic
1095108720 12:38267138-38267160 CTGTCAGGAGGTGGGGATCTAGG + Intergenic
1095115182 12:38344330-38344352 AGGTGAGGACATGAGGATGTGGG - Intergenic
1095115190 12:38344360-38344382 TGGTGAGGATGTGCAGATGTAGG - Intergenic
1095824471 12:46516816-46516838 TTGTGAGGTGGTGAGGATGTGGG + Intergenic
1097173388 12:57129355-57129377 GTGGGGGGTTGTGAGGATGTAGG - Intronic
1098807481 12:75037775-75037797 GTGTGGGGATGTGGGGATGTGGG + Intergenic
1098883378 12:75939375-75939397 CTGGGAGGATGGGAGGCTGTGGG + Intergenic
1098914243 12:76240719-76240741 TGGTGAGGACGTGAGGATGCGGG - Intergenic
1100526657 12:95425937-95425959 TGGTGAGGATGTGGGGAAGTTGG - Intergenic
1100552044 12:95654871-95654893 ATGATGGGATGTGAGGATGTTGG + Intergenic
1100552046 12:95654879-95654901 ATGTGAGGATGTTGGGATGTTGG + Intergenic
1100552101 12:95655103-95655125 ATGATGGGATGTGAGGATGTTGG + Intergenic
1100552103 12:95655111-95655133 ATGTGAGGATGTTGGGATGTTGG + Intergenic
1100552188 12:95655447-95655469 ATGTGGGGATGTTGGGATGTTGG + Intergenic
1100787850 12:98097519-98097541 ATTCGAGGATGTGAGGATTTTGG + Intergenic
1102398556 12:112609085-112609107 CTGTGAGGATTTGGGGAAGATGG - Intronic
1102750842 12:115292622-115292644 CTGTTAGGAGATGAGGCTGTTGG - Intergenic
1102807449 12:115794419-115794441 GAGTGAGGAAGTGAGGAGGTGGG + Intergenic
1103052559 12:117792907-117792929 GTGTGAGGGTGTGTGCATGTTGG - Intronic
1103052573 12:117793201-117793223 GTGTGAGGGTGTGTGCATGTTGG - Intronic
1103359497 12:120345557-120345579 GTGGCAGGAGGTGAGGATGTGGG - Exonic
1103536870 12:121639205-121639227 CTGCTTGGGTGTGAGGATGTGGG + Intronic
1104290555 12:127462525-127462547 ATGTGAAGATGTGAGGCTGCTGG - Intergenic
1104367262 12:128189274-128189296 GTGTGAGAATGTGAGGGTGAGGG + Intergenic
1104367283 12:128189469-128189491 GTGTGAGAATGTGAGGGTGAGGG + Intergenic
1104470316 12:129024900-129024922 GTGTGGGGGTGTGAGCATGTGGG - Intergenic
1104470366 12:129025148-129025170 GTGTGTGGGTGTGAGCATGTGGG - Intergenic
1104777058 12:131396301-131396323 ATGTGATGACGGGAGGATGTTGG + Intergenic
1105279992 13:18957889-18957911 CTGGGAGGATGTGGGGGTTTGGG - Intergenic
1105614704 13:22001214-22001236 CTGTGACCATGATAGGATGTGGG + Intergenic
1106978549 13:35251330-35251352 TGGTGAGGATGTGAGGAAGCTGG - Intronic
1107198281 13:37682017-37682039 CTGTGAGGATGTGATGGGGTAGG + Intronic
1107393101 13:39987743-39987765 CTGTGAGTATTTGAAGATATTGG + Intergenic
1109255889 13:60081676-60081698 CTGTGCGGATTTGTGGCTGTTGG - Intronic
1109528959 13:63614875-63614897 CTGAGGAGATGTGAGGATGAAGG + Intergenic
1109761269 13:66832977-66832999 CTGTTATGATGTGAAGAGGTGGG - Intronic
1110015595 13:70397322-70397344 CAGTGAGCAAGTGAGGATATTGG - Intergenic
1112386559 13:98945590-98945612 CTGTGATGGTGGCAGGATGTAGG - Intronic
1112416184 13:99205315-99205337 TTGTGAGGAGGTGAGGATCCGGG + Intronic
1112994789 13:105560429-105560451 ATGTGATGATGTGAGGAAGTGGG - Intergenic
1113399251 13:109976141-109976163 ATGTGAGGAGGTGAGGTTGTGGG + Intergenic
1113660383 13:112103489-112103511 CTGAGTGGATGTGGGGATGGAGG + Intergenic
1113671566 13:112178974-112178996 CTGTGAGGCTGTGGGGCAGTGGG + Intergenic
1113882348 13:113634448-113634470 CTGTGAGGATGTGAGGATGTGGG + Intronic
1113964016 13:114142123-114142145 CTGTGTGCATGTGTGCATGTGGG - Intergenic
1115208437 14:30939853-30939875 ATGGGAGGAAGTGTGGATGTGGG - Intronic
1116023519 14:39488934-39488956 CTGTGTGGAAGTGAAGATGGAGG - Intergenic
1117391568 14:55267493-55267515 CTGTGGGGATAGGAGGATCTGGG + Intergenic
1118082248 14:62374250-62374272 CTGTGAGGAGATGAGGAGATGGG - Intergenic
1119562909 14:75605186-75605208 CTGTGTGGATTGCAGGATGTAGG + Intronic
1120415902 14:84217524-84217546 CTGTGATGATTTTAGGAGGTGGG + Intergenic
1121003169 14:90466588-90466610 CTGCCAGGAAGTGAGGAGGTGGG + Intergenic
1121101791 14:91254427-91254449 CTGTGAGGATGTGGGGCAGAGGG - Intergenic
1121794981 14:96727340-96727362 ATGTGGGCATGTGGGGATGTGGG + Intergenic
1122296176 14:100706967-100706989 GTGTGAGGGTGTGAGAGTGTAGG - Intergenic
1122296179 14:100707015-100707037 GTGTGAGGGTGTGAGAGTGTAGG - Intergenic
1122642785 14:103170380-103170402 TGGTGAGGATGTGCAGATGTGGG - Intergenic
1122863326 14:104592318-104592340 CTGGGAGGATGTGAGTGTGAGGG - Intronic
1123706551 15:22955181-22955203 CTGTGTGGATCTGAGGCTGAGGG - Intronic
1125021495 15:34991056-34991078 CTGTGAAGATTTGAGGGTGTGGG + Intergenic
1125191942 15:37003737-37003759 ATGTGAGGATATTAGGAAGTGGG + Intronic
1125408809 15:39383429-39383451 ATGTGAGGATATTAGGAAGTGGG - Intergenic
1127167644 15:56263714-56263736 TTGTCAGGATCTGAGGATATGGG - Intronic
1127837846 15:62805132-62805154 CTGAGAGGATGTGAGGTTGGGGG - Intronic
1131107789 15:89746546-89746568 CTGTGTGTATGTGTGGAGGTTGG - Intergenic
1131179458 15:90230088-90230110 GTGGGAGGGTGTGAGGATGAAGG - Exonic
1131800128 15:96059863-96059885 CTGTGAGGAAGTAAGGAGGTTGG + Intergenic
1132870974 16:2115626-2115648 CTGTGAGGAGGGGAGGGTGTTGG + Intronic
1132871355 16:2117093-2117115 CTGTGAGGGTGGGAGGATGGAGG - Intronic
1133890713 16:9876395-9876417 TGGTGAGGACGTGCGGATGTGGG - Intronic
1134521172 16:14919801-14919823 CTGTGAGGGTGGGAGGATGGAGG + Intronic
1134521555 16:14921257-14921279 CTGCGAGGAGGGGAGGGTGTTGG - Intronic
1134550399 16:15136171-15136193 CTGTGAGGGTGGGAGGATGGAGG - Intronic
1134708848 16:16318452-16318474 CTGTGAGGGTGGGAGGATGGAGG + Intergenic
1134709226 16:16319908-16319930 CTGCGAGGAGGGGAGGGTGTTGG - Intergenic
1134716059 16:16358486-16358508 CTGTGAGGGTGGGAGGATGGAGG + Intergenic
1134716435 16:16359937-16359959 CTGCGAGGAGGGGAGGGTGTTGG - Intergenic
1134950379 16:18348737-18348759 CTGCGAGGAGGGGAGGGTGTTGG + Intergenic
1134950757 16:18350193-18350215 CTGTGAGGGTGGGAGGATGGAGG - Intergenic
1134958315 16:18392222-18392244 CTGCGAGGAGGGGAGGGTGTTGG + Intergenic
1134958697 16:18393673-18393695 CTGTGAGGGTGGGAGGATGGAGG - Intergenic
1135231936 16:20716643-20716665 AGGTGAGGGTGTGAGGATGTGGG - Intronic
1136173320 16:28501445-28501467 CTGTGAGTGTGTGAGTGTGTGGG - Intronic
1136270619 16:29146292-29146314 CTGTGGGGATGTGGGGATTGAGG + Intergenic
1136270629 16:29146322-29146344 CTGTGGGGATGTGGGGATGGGGG + Intergenic
1136270639 16:29146352-29146374 CTGTGGGGATGTGGGGACGGGGG + Intergenic
1136270674 16:29146472-29146494 CTGTGGGGATGTGGGGATGGAGG + Intergenic
1136649918 16:31660328-31660350 AGGTGAGGATGTGAGGATGTGGG - Intergenic
1136650763 16:31668165-31668187 AGGTGAGGACGTGAGGACGTGGG - Intergenic
1137415520 16:48274671-48274693 GTGTGTGGATGTGTGGGTGTGGG - Intronic
1137578383 16:49618911-49618933 GTGAGAGAAGGTGAGGATGTTGG - Intronic
1138091610 16:54179061-54179083 CTGTGATGATGTGATGATATGGG - Intergenic
1138477081 16:57277741-57277763 CTGTGGTTAAGTGAGGATGTGGG + Intronic
1138793303 16:59935324-59935346 CGGTGAGGATGTGAAGAAATTGG - Intergenic
1138954365 16:61952984-61953006 ATGTGAGGATGGTAGGAGGTAGG + Intronic
1139923050 16:70471465-70471487 CTGTGAGGAGGGTCGGATGTAGG + Intronic
1141689295 16:85587441-85587463 CAGTGTGCATGTGAGGCTGTGGG + Intergenic
1142038769 16:87879103-87879125 CTGTGAGGATGGAAGTTTGTAGG + Intergenic
1142074207 16:88108103-88108125 CTGTGGGGATGTGGGGATGGAGG + Intronic
1142074217 16:88108133-88108155 CTGTGGGGATGTGGGGATGGGGG + Intronic
1142074226 16:88108163-88108185 CTGTGGGGATGTGGGGATGGAGG + Intronic
1142074253 16:88108253-88108275 CTGTGGGGATGTGGGGATGGAGG + Intronic
1144625893 17:16844325-16844347 CTGTGAGGATCTGCGGAGATGGG + Intergenic
1146163058 17:30570254-30570276 CTGTGAGGATCTGAGGAGATGGG + Intergenic
1146492888 17:33294568-33294590 CTGTGTGGATGTATGTATGTGGG - Intronic
1147311030 17:39596373-39596395 CTGTGTGTATGTGTGTATGTGGG + Intergenic
1147580045 17:41623023-41623045 CTGTGAGGATCTGAGGAGAAGGG + Exonic
1147920399 17:43913024-43913046 CTGTGTGTATGTGAGTGTGTAGG - Intergenic
1148518124 17:48241344-48241366 CTGTGTGCATGTGTGGAGGTGGG + Intronic
1148586065 17:48781432-48781454 CGGTGAGGATGTGGAGATATTGG - Intronic
1148661147 17:49333887-49333909 TGGTGAGGATGTGAAGATATTGG + Intronic
1149074472 17:52579517-52579539 CAGGGAGGATGTGATGATTTTGG - Intergenic
1149340571 17:55681746-55681768 CTCTGAAGATCTGGGGATGTAGG + Intergenic
1150603895 17:66675212-66675234 GTGTGAGGATGTGGGGCTGTCGG - Intronic
1151297787 17:73198236-73198258 CTGTAAGGATGTGAGAAGGGAGG + Intronic
1151392579 17:73797667-73797689 CTGGGAGGAGGTGTGGATGGAGG - Intergenic
1152733485 17:81985181-81985203 GTGTGTGGATGTGTGCATGTTGG - Intronic
1152844920 17:82593743-82593765 GGGTGAGGATTTGATGATGTGGG + Intronic
1153108360 18:1554857-1554879 CTGTGAGGAGGTTGGGAGGTGGG - Intergenic
1153662061 18:7333806-7333828 GTGTGAGGATGAGAGGATCCCGG - Intergenic
1153912168 18:9713961-9713983 ATGTGAGGATATTAGGAGGTGGG - Intronic
1155221128 18:23687101-23687123 TTGTGAGGATGTGGAGAAGTTGG - Intergenic
1155796554 18:30044818-30044840 AGGTGAGGATGTGAGGACGTGGG - Intergenic
1156260314 18:35440069-35440091 CTGTGAGGGTGAGAAGTTGTGGG - Intergenic
1156350037 18:36295996-36296018 CTGTGAGGAGATGCGGAAGTTGG + Intergenic
1157177831 18:45467399-45467421 CTGTCAGGATATGAGGTTGCAGG - Intronic
1157253091 18:46113640-46113662 CTGTGAGAATGACAAGATGTTGG - Intronic
1157474204 18:48011080-48011102 GTGTGAGGAGGTGGGGAGGTAGG + Intergenic
1157479472 18:48044323-48044345 ATGGGAGGATGTGGAGATGTAGG - Intronic
1157523628 18:48362352-48362374 ATGTGATGGTGTGAGGAGGTGGG + Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1160197387 18:76767255-76767277 CTGTGAGAATGAGTAGATGTAGG - Intergenic
1161326654 19:3667516-3667538 CTGGGAGGATGTGATGAGGGTGG + Intronic
1161755727 19:6132443-6132465 CTGAGGGTGTGTGAGGATGTGGG + Intronic
1162006642 19:7785048-7785070 TGGTGAAGATGTGAGGAAGTGGG - Intergenic
1162270229 19:9608338-9608360 CTGTGAAGACATGAGGAAGTGGG + Exonic
1163628636 19:18405079-18405101 CTCTGAGGACCTGAGGGTGTTGG - Intergenic
1163676568 19:18658307-18658329 CTGTGAGGCTGAGAGGTTGGTGG + Intronic
1163919239 19:20273327-20273349 TGGTGAGGATGTGTGGATGTGGG + Intergenic
1165231513 19:34390204-34390226 TTGTCAGTATCTGAGGATGTGGG + Intronic
1165231760 19:34391677-34391699 CTGTCAGTATCTGAGGAGGTAGG + Intronic
1165231882 19:34392575-34392597 CTGTCAGTATCTGAGGAGGTAGG + Intronic
1165642460 19:37401859-37401881 TAGTGAGGATGTGAAGATATTGG - Intergenic
1166120985 19:40686725-40686747 CTGTAAGGGTGTCAGGGTGTGGG + Intronic
1166392080 19:42413976-42413998 CTGTGAAAATGGGACGATGTGGG + Intronic
1167494763 19:49811257-49811279 CTGAGAGGATAGGAGGAGGTTGG + Intronic
1168599190 19:57704641-57704663 CTGTGAGGCTGTGAGGAAACAGG + Intronic
926130370 2:10299691-10299713 CGGTGAGGATGTGAAGAAATTGG + Intergenic
926449210 2:12981872-12981894 ATGTGAGGATATTAGGAAGTGGG - Intergenic
926688500 2:15716825-15716847 CTGTTAGGATATCACGATGTTGG + Intronic
927382972 2:22500080-22500102 CTGAAAGGATGTGAGGCAGTAGG - Intergenic
927517817 2:23682317-23682339 CCCTGAGGCTCTGAGGATGTGGG + Intronic
928779985 2:34806203-34806225 GTCTGAGGATCTGAGGTTGTAGG + Intergenic
928906741 2:36376521-36376543 CTGTGGGGATACGAGAATGTGGG + Intronic
929571072 2:43023407-43023429 CAGAGAGGATGTGAGGAGGCCGG + Intergenic
930771943 2:55137934-55137956 CTGAGAGGACATGAGGATGGAGG - Intergenic
930806073 2:55492058-55492080 CTGTGAGGAAGTAAGGAAGGTGG + Intergenic
932270572 2:70405430-70405452 TGGTGAGGATGTGAGGATGTGGG - Intergenic
932285947 2:70531929-70531951 GTGTGAGTATGTGAGAGTGTGGG - Intronic
933100707 2:78253146-78253168 TGGTGAGGATGTGATGATGTGGG - Intergenic
934706733 2:96486427-96486449 CTACGAGGAGGTGAGGAGGTCGG - Intergenic
935279447 2:101504873-101504895 AGGTGAGGAGGTGAGGAGGTGGG - Intergenic
935334635 2:102005217-102005239 CTGAGAGAATGTGAGCATGGTGG + Intronic
935469874 2:103445449-103445471 GTGTTTGGATGTGAGGATCTTGG + Intergenic
936153395 2:110033602-110033624 CTGGGAGGATGTGAGCAGCTTGG + Intergenic
936191286 2:110337813-110337835 CTGGGAGGATGTGAGCAGCTTGG - Intergenic
936526870 2:113247237-113247259 GTGTAAGGAATTGAGGATGTGGG + Intronic
937242568 2:120471806-120471828 CTGTGATGGTGTTAGGAGGTGGG - Intergenic
937290063 2:120776691-120776713 CTGTGAGGCTGTGAGGTTAGAGG + Intronic
937488731 2:122342892-122342914 CTGAGAGGCAGTGAGGTTGTTGG - Intergenic
937826026 2:126369295-126369317 CTGTGAGGGTCTGAGAAGGTTGG + Intergenic
939054471 2:137347057-137347079 TGGTGAGGATGTGGGGATATTGG - Intronic
941683511 2:168424703-168424725 CTGTGAGGCTGATATGATGTGGG + Intergenic
942000512 2:171641915-171641937 CTGGGAGGATGTGAAGAAATAGG - Intergenic
942328356 2:174794721-174794743 CTGTGAGAAGGTGATGACGTGGG - Intergenic
945894941 2:215471226-215471248 GTGTGAGGCTGTGGGTATGTTGG + Intergenic
946144562 2:217719311-217719333 CTGTGACGTTATGAGGATGAAGG + Intronic
946349471 2:219140042-219140064 CTTTAAGGAAGTGAGGAAGTTGG + Intronic
947077377 2:226360053-226360075 CTGTGAGTATGTGAATATGTTGG + Intergenic
947397595 2:229701802-229701824 CTACGAGGAAGTGAGCATGTTGG + Intronic
947572854 2:231249496-231249518 GTGTCAGGATGTGGGGAGGTGGG - Intronic
947795980 2:232894276-232894298 CACTCAGGAGGTGAGGATGTGGG + Intronic
947837776 2:233187971-233187993 CTTGGCGGCTGTGAGGATGTGGG - Intronic
947844441 2:233232607-233232629 CTCTGAGGAGGTGAGGGAGTTGG - Intronic
948665172 2:239530028-239530050 ATGGGAGGAAGTGAGGGTGTAGG - Intergenic
1169308357 20:4514431-4514453 CTGTGAGTGTGTGTGCATGTAGG + Intergenic
1170446655 20:16434940-16434962 CAGTGTGGCTGTGAGGATGGGGG + Intronic
1170499029 20:16955780-16955802 CTGTGAGAAGGTGACGAAGTCGG + Intergenic
1171116338 20:22527742-22527764 AAGTGGGGATGTGATGATGTAGG + Intergenic
1172960947 20:38799203-38799225 CTGTGATGCTGTGAGGATAGGGG - Intergenic
1173042210 20:39475130-39475152 CTGTGAGGAGGTGTGGAGGAGGG + Intergenic
1173898445 20:46568843-46568865 CTGTGTGGCTGCGAGGATGCTGG - Intronic
1174125736 20:48304281-48304303 CTCAGTAGATGTGAGGATGTGGG + Intergenic
1175717639 20:61266047-61266069 CTGAGAGTATGTGGGGATTTAGG + Intronic
1175880306 20:62254189-62254211 ATGTGACAATGTTAGGATGTGGG - Intronic
1178398380 21:32262548-32262570 CTGTGTGGATCTGAGGAAATGGG - Intergenic
1178680945 21:34671016-34671038 CAATGAGGATGTGGGGTTGTGGG + Intronic
1178714188 21:34948543-34948565 CTCTGGGGCTGTGAGAATGTGGG + Intronic
1179095338 21:38309601-38309623 CTGTGAGGCTGTGAGTCTGTTGG - Intergenic
1182446563 22:30393059-30393081 CTGGGAGGAGGGGAGGAGGTTGG + Intronic
1182841167 22:33391152-33391174 CTATGAGGATGTGAGGATATTGG - Intronic
1182841287 22:33392090-33392112 CTCTGAGGATGTGAGGATATTGG - Intronic
1183310190 22:37105388-37105410 CTGTGAACATTTGAGGAAGTGGG - Intronic
1183629871 22:39026436-39026458 CTGTGAGGAGGTGGGGTTGAGGG + Intronic
1183633313 22:39046295-39046317 CTGTGAGGAGGTGGGGATGAGGG + Intronic
1183748777 22:39707311-39707333 CTGAGAGGAGGAGAGGATGCTGG + Intergenic
1183792889 22:40088151-40088173 CTGTGAGGATGAGACGAGATAGG - Intronic
1183799905 22:40153728-40153750 TTGTGAGGAAGGGAGGATGGAGG + Intronic
1184717438 22:46290013-46290035 CTGTGAGGTCGGGAGGCTGTGGG + Intronic
949777277 3:7647127-7647149 CCGTGTGGGTATGAGGATGTGGG + Intronic
950205451 3:11076793-11076815 CAGGGAGGAAGGGAGGATGTGGG - Intergenic
950528592 3:13539433-13539455 TTGTGTGGGTGTGAGGTTGTTGG + Intergenic
950576139 3:13833167-13833189 GTGTGAGGGTGTGAGCCTGTGGG - Intronic
951562889 3:23985882-23985904 TGGTGAGGATGTGGGGAAGTTGG + Intergenic
952726505 3:36591998-36592020 ATGTGATGATGTTAGGAAGTGGG - Intergenic
953044514 3:39282547-39282569 CAGAGAGGCTGTGAGGATGGTGG + Intergenic
953456312 3:43045036-43045058 AGGTGAGGGTGTGAGGATGTGGG + Intronic
953778616 3:45844910-45844932 CTCTAAGAATGTGTGGATGTTGG + Intronic
953843190 3:46406437-46406459 CTGTGGGGAGGGGAGGCTGTGGG - Intergenic
954608909 3:51933987-51934009 CAGTGAGTTTGTGAGGATGAAGG + Intronic
954945980 3:54424749-54424771 ATGTGGGGATGGGAGGATGCAGG - Intronic
956498225 3:69851835-69851857 TTGTGAGCATGTGAGCATATTGG - Intronic
958766631 3:98376889-98376911 CTGCGGGGAAGTGAGGATTTTGG + Intergenic
959391605 3:105781771-105781793 CTGTGAGGATGTGCTGCTTTTGG + Intronic
959638280 3:108601249-108601271 GTGTGTGGATGTGTGGGTGTGGG + Intronic
959847843 3:111055209-111055231 TGGTGAGGATGTGTGGATGTGGG - Intergenic
960580782 3:119276852-119276874 ATGTGAAGATGTGAAGATGAAGG - Intergenic
960797799 3:121506402-121506424 CTGGGGGAATGTGAGGAGGTTGG - Intronic
961002818 3:123385336-123385358 GTGTGTGGCTGTGAGTATGTGGG + Intronic
961260147 3:125595522-125595544 CTGTGGGGCTGTGGGGCTGTGGG - Intergenic
961260150 3:125595530-125595552 CTGTGGGGCTGTGGGGCTGTGGG - Intergenic
961638846 3:128352165-128352187 GTGTCAGGAGGTGAGGATGGGGG - Intronic
961640081 3:128359751-128359773 CTGTGAGGATGGAAAGCTGTGGG + Intronic
961861710 3:129921742-129921764 CAGTGAGGATGTAAGCCTGTGGG + Intergenic
963065804 3:141263544-141263566 CTGTCAGGATGTGAAGACTTAGG + Intronic
963196732 3:142540179-142540201 CTGTTAAGATTTTAGGATGTTGG - Intronic
963949602 3:151184618-151184640 GACTGAGGATGAGAGGATGTTGG - Intronic
964319489 3:155480340-155480362 CCGTGAGGGTGTGAGGAAGAAGG - Exonic
964512155 3:157464485-157464507 CAGTGCAGATGTGAGCATGTTGG + Intronic
964525424 3:157611566-157611588 CTGTGAAGATGTGGGCATGTTGG + Intronic
965103474 3:164332539-164332561 CTGTGAGGGAGAGAGGAAGTGGG + Intergenic
967907545 3:194514137-194514159 TTGGGAGGATGTGTGTATGTGGG - Intergenic
968505550 4:969561-969583 CTGTGAGCATGCCAGGATGGCGG + Intronic
968742145 4:2336660-2336682 GAGTGAGGATGTGAGGATTGAGG + Intronic
969145777 4:5123085-5123107 CTGTGGGGAGGTGGGGAAGTTGG - Intronic
969230031 4:5823914-5823936 CTGTGAGGTTGTTATGATGTTGG + Intronic
969878687 4:10155533-10155555 CTCTGAGGATGTCTGGATGAGGG - Intergenic
969979638 4:11141508-11141530 AGGTGAGGAGGTGAGGGTGTGGG - Intergenic
970084444 4:12330963-12330985 CTTTGAGGATGTCAGGATATTGG - Intergenic
970929686 4:21495175-21495197 CTGGCTGGATGTTAGGATGTTGG + Intronic
973054629 4:45640663-45640685 AGGTGAGGATGTGAGGACATGGG - Intergenic
973195469 4:47434753-47434775 TTGGGATGATGTGTGGATGTTGG - Intergenic
973653514 4:53021675-53021697 CTATCAGGATTTGAAGATGTGGG + Intronic
973862380 4:55077966-55077988 CTGGGAGGAGGTGTGGGTGTTGG + Intergenic
973973171 4:56235664-56235686 CAATGAGGATTTGTGGATGTGGG - Intronic
975184851 4:71389470-71389492 GAATGAGGATGTGAGGATGGAGG - Intronic
975802915 4:78081114-78081136 CTGTGAGGATGGGGGTTTGTGGG + Intronic
976136678 4:81945107-81945129 CTGTGGGGAGGTGGGGATGGGGG + Intronic
976940771 4:90699771-90699793 ATGTGATGATGGTAGGATGTGGG + Intronic
977432434 4:96947340-96947362 GTGAGAGGATGGGAGGAGGTTGG + Intergenic
977535662 4:98254016-98254038 CTGTGAGCATGTGTACATGTAGG + Intergenic
977986979 4:103394432-103394454 CAGTCAGGATCTGTGGATGTGGG + Intergenic
979478044 4:121181223-121181245 ATGGGAGGATATGAGGATGAGGG + Intronic
981697421 4:147573079-147573101 CTGTGATGGTGTTAGGAGGTGGG + Intergenic
984205713 4:176785538-176785560 GAGTGGGGATGTGAGGAGGTGGG - Intronic
985500040 5:237521-237543 CCGTGAGGATGTCTGGAGGTGGG - Intronic
985516097 5:345480-345502 GTGTGGGGATGTGTGTATGTGGG + Intronic
986019159 5:3785070-3785092 CAGTGTGGATGTGAGTGTGTGGG - Intergenic
986593625 5:9397205-9397227 CTGTGTGGATGTGTATATGTGGG - Intronic
986867895 5:12011276-12011298 TTGTGAATATGTGAGGATGAGGG - Intergenic
987287553 5:16472781-16472803 GTGTGAGGATGGGAGGAAGTTGG - Intergenic
988660024 5:33255769-33255791 TTGTGAGGGAGTGAGGAAGTAGG - Intergenic
988700726 5:33671923-33671945 GTGTGTGTATGTGAGTATGTGGG - Intronic
988700761 5:33672295-33672317 CTGTGTGTATATGAGTATGTGGG - Intronic
988807529 5:34754129-34754151 AGGAGAGGATGAGAGGATGTAGG + Intronic
989152513 5:38314431-38314453 TTATGTGAATGTGAGGATGTGGG + Intronic
991154191 5:63411186-63411208 TGGTGAGGATGTGAGGGAGTTGG - Intergenic
991181991 5:63763287-63763309 ATGTGATGATGTCAGGATGCAGG - Intergenic
994167860 5:96626566-96626588 CTGAGAAGATGGGAGGAGGTGGG - Intronic
995386360 5:111594048-111594070 CTGTGAGGGGGTGAGGAGCTAGG + Intergenic
996907996 5:128623796-128623818 ATGTCTGCATGTGAGGATGTGGG - Intronic
997123856 5:131205657-131205679 CAGTGAGGATGTGGGGAAATGGG - Intergenic
997857514 5:137385583-137385605 CTGTGAGGAGGAGTGGCTGTTGG - Intronic
998154255 5:139775502-139775524 CTCTGGGCCTGTGAGGATGTTGG - Intergenic
998377051 5:141698186-141698208 CCGGCAGGCTGTGAGGATGTGGG - Intergenic
998952422 5:147405453-147405475 CTGTGTGGATGGGAGGATCCTGG - Intronic
999075869 5:148794744-148794766 GTGTGAGCACGGGAGGATGTGGG + Intergenic
999267908 5:150278820-150278842 GTGTGATGCTGTGAGGCTGTAGG + Intronic
1000115511 5:158149911-158149933 CTGTGAGGATGTGAGGATGCAGG + Intergenic
1000311051 5:160045070-160045092 ATGTGAGGATGTGTGGGTTTGGG + Intronic
1000459651 5:161498971-161498993 ATGTGAGGACGTGAGGACGTGGG - Intronic
1000459658 5:161499009-161499031 TGGTAAGGATGTGTGGATGTGGG - Intronic
1000988937 5:167891870-167891892 CTGTGCTGCTGTGAGGAAGTGGG - Intronic
1002819105 6:707197-707219 GAGTGTGGACGTGAGGATGTAGG - Intergenic
1003944873 6:11065682-11065704 CTGTGAGGGAGTGAGGAAGCAGG - Intergenic
1004696540 6:18039135-18039157 TTGTGAGGATGTGAAGAAATTGG + Intergenic
1005036296 6:21558136-21558158 ATGTGATGATGTTAGGAAGTGGG + Intergenic
1005593466 6:27352734-27352756 AGGTGAGGACGTGAGGACGTGGG - Intergenic
1006059572 6:31410371-31410393 CTGTGAGGGTGGGAGGATAGAGG - Intronic
1006072061 6:31505442-31505464 CTGTGAGGGTGGGAGGATAGAGG - Intronic
1006099462 6:31677170-31677192 GTGTGGGGATGAGAGGATTTGGG - Intronic
1006558816 6:34891147-34891169 CTTGAAGGATGTGAGGATTTGGG + Intronic
1007076640 6:39072490-39072512 CTGTGAGGCATTTAGGATGTGGG + Intronic
1007694175 6:43721410-43721432 ATGTGAGAATGTGAGAATGGTGG - Intergenic
1007709333 6:43811824-43811846 GTGTGGGGATGTGAGGATGGGGG + Intergenic
1008012986 6:46488939-46488961 CTGTGGAGGTGTGAGGAGGTGGG - Intronic
1008045903 6:46850975-46850997 CTGTGGGGTTTTCAGGATGTAGG - Intergenic
1008422588 6:51319511-51319533 CTCTGAGGATGAGAGGAAGCAGG - Intergenic
1011664562 6:89622051-89622073 CTCTGAGCATGGGTGGATGTGGG - Intronic
1012122454 6:95384982-95385004 CTTTGAGGCTGTGAGGTTCTTGG + Intergenic
1012148091 6:95711502-95711524 CTGCTAGGGTGTGAGGAAGTGGG + Intergenic
1013455276 6:110324261-110324283 CTGTGGGGATGTGAGACTGTGGG - Intronic
1014269003 6:119314802-119314824 CTGTGAGAATTGAAGGATGTAGG - Intronic
1014456533 6:121641260-121641282 CTGTCAGCAAGGGAGGATGTTGG - Intergenic
1014937087 6:127397660-127397682 AGGTGAGGACGTGAGGACGTGGG - Intergenic
1014937094 6:127397690-127397712 TGGTGAGGATGTGAGGATGTGGG - Intergenic
1015062969 6:128989965-128989987 ATGTGAGGATATCAGGAGGTGGG - Intronic
1015689480 6:135905719-135905741 CTGTGTGGGTGCGAGGGTGTGGG + Intronic
1016864656 6:148753810-148753832 CAGTGAGGATGTGAAGAAATTGG - Intronic
1017120540 6:151019947-151019969 TTGTGAGGGTGTGGGGTTGTAGG - Intronic
1017825080 6:158075824-158075846 CTGAGAGGATGTGAGAATGTTGG - Intronic
1017882715 6:158572900-158572922 TTGTGAGGTTGTGAGGTTGTGGG + Intronic
1017889501 6:158627044-158627066 GTGTGAGGGTGTGAGAATGAGGG - Intronic
1018900944 6:168051450-168051472 CGGTGAGGTTGTGAGGATGGAGG + Intergenic
1019029659 6:168999484-168999506 CTGTGGTGGTGTGAGGATGCTGG + Intergenic
1019105434 6:169663726-169663748 AGGTGAGGATGTGAGGGTGCTGG + Intronic
1019446280 7:1073309-1073331 CGGTGAGGAGGTGAGGAGGGAGG - Intronic
1019453115 7:1109880-1109902 CCGTGAGGAGGTGAGGATGGAGG - Intronic
1019489355 7:1304405-1304427 CTCTGTGGATTTGAGGATCTAGG + Intergenic
1019503248 7:1376146-1376168 CTGTAAGGAGGTGGGGATGCCGG - Intergenic
1019563104 7:1667574-1667596 CTGAGTGGATTTGAGGATCTGGG + Intergenic
1021268085 7:18549787-18549809 CTGTGTGTATGTGTGGGTGTGGG - Intronic
1021496986 7:21286115-21286137 CTGTGAGGATGTGAAGAAATTGG + Intergenic
1022186936 7:27978851-27978873 GTGTGAGGGCGTGAGGGTGTAGG + Intronic
1024035634 7:45505691-45505713 CTGTGGGGCTGAGTGGATGTTGG + Intergenic
1024087851 7:45911502-45911524 CTGCAAGGCTGTGAGGATGGAGG - Intergenic
1024229291 7:47351899-47351921 CTGTGTGCATGTGAGTATGTGGG - Intronic
1024630432 7:51242843-51242865 CTGTGCGGAGGTGATAATGTTGG - Intronic
1024779924 7:52836129-52836151 CAGTTAGTATGTGAGGATGTGGG - Intergenic
1025709216 7:63891688-63891710 GTGGGAGGGTGTGGGGATGTGGG - Intergenic
1027318571 7:76998734-76998756 GTGTGTGGAGGTGAGGGTGTGGG + Intergenic
1027816562 7:82980153-82980175 CTGAGCAGGTGTGAGGATGTGGG - Intronic
1028334624 7:89636590-89636612 CTGCAGGAATGTGAGGATGTAGG + Intergenic
1029158883 7:98537093-98537115 AAGGGAGGATGGGAGGATGTTGG + Intergenic
1030068889 7:105681409-105681431 TGGTGAGGATGTGGGGAAGTTGG + Intronic
1030231397 7:107211395-107211417 CTGTGAGCACGTGGGCATGTGGG - Intronic
1030974739 7:116107460-116107482 CTGTGAAGATGTGAGCCTGGAGG + Intronic
1032284910 7:130532551-130532573 TTGTGTGGATGTGAGGAGGAGGG + Intronic
1032329414 7:130963699-130963721 CAGCGAGCATGTGAGGATATTGG - Intergenic
1032794247 7:135264763-135264785 CTCTGAGGATGTTAGTGTGTTGG - Intergenic
1034639571 7:152591988-152592010 CTGCCAGGGTGTGAGGAGGTGGG + Intergenic
1035768269 8:2126363-2126385 GTGTGGGGATGTGAGTGTGTGGG - Intronic
1036013397 8:4753587-4753609 CTGTGAGGATGTCAGGTTCATGG - Intronic
1036591949 8:10176406-10176428 CTGAGGGGATGTGAGGATGGTGG + Intronic
1037164372 8:15809215-15809237 CAGTGAGGGTGTGAGGATGTTGG + Intergenic
1037241953 8:16787191-16787213 CTGGGAGGAAGTGAGGATCGTGG - Intergenic
1037579758 8:20237359-20237381 GTGTGTGGATGTGTGGATGTGGG - Intergenic
1037674654 8:21043161-21043183 GTGTGGGGAGGTGGGGATGTGGG - Intergenic
1039802341 8:40970176-40970198 TTTTGAGGCTGTGAGAATGTGGG + Intergenic
1041436764 8:57850309-57850331 ATGTGATGATATGAGGACGTAGG - Intergenic
1041551043 8:59101975-59101997 CTGTGGGCAGGTGAGGATGCAGG + Intronic
1041671846 8:60499723-60499745 TGGTGAGGATGTGTGGATGTGGG - Intergenic
1042865408 8:73352667-73352689 ATGTGATGATATGAGGATGTGGG + Intergenic
1042919517 8:73908073-73908095 CTGTAAGGAAGCTAGGATGTAGG - Intergenic
1044993992 8:97821525-97821547 TAGTGAGGACGTGTGGATGTAGG + Intronic
1047063625 8:121255371-121255393 CTTTGAGGATGGAAGGATGGGGG + Intergenic
1047506764 8:125486335-125486357 ATGTGGGGATGTCGGGATGTCGG - Intergenic
1047506766 8:125486343-125486365 CTCTCGGGATGTGGGGATGTCGG - Intergenic
1047686519 8:127310294-127310316 CTGTGAGTATGTGATGAGATGGG + Intergenic
1048315691 8:133360214-133360236 CTGGGTGGCTGTGAGGATTTGGG - Intergenic
1049171755 8:141165878-141165900 CTTTGAGGATGGGGGGAGGTGGG - Intronic
1049319286 8:141987403-141987425 CTGTCAGGAGGTCAGGAGGTAGG + Intergenic
1049371661 8:142270932-142270954 CCGGAAGGATGAGAGGATGTGGG - Intronic
1049499631 8:142955022-142955044 CTGTGAGGGTGTAAGGAAGGGGG - Intergenic
1049588336 8:143442047-143442069 CTGTGTGGCTGGGAGGATGTGGG - Intronic
1049692554 8:143968860-143968882 TGGTGAGGATGTGAGGAAATTGG + Intronic
1049983181 9:923436-923458 CTGAGAGAGGGTGAGGATGTTGG + Intronic
1050080989 9:1915773-1915795 GTGTGAGGGTGTGAGGATGAAGG - Intergenic
1050710914 9:8462200-8462222 CTGAGAGGATGAGAGAATTTGGG - Intronic
1051273499 9:15377261-15377283 CTTTGAGGATGTGAAGAACTGGG - Intergenic
1052649799 9:31287634-31287656 CTGTCAGGAGGTGGGGATCTAGG + Intergenic
1052697624 9:31898551-31898573 CTGTCAGGAGGTGGGGAGGTAGG - Intergenic
1052749222 9:32472032-32472054 CTGTGAGGTGGTCAGGATGAGGG + Intronic
1052892647 9:33718778-33718800 ATGTGATGGTGTTAGGATGTAGG + Intergenic
1056885088 9:90433981-90434003 CTGGGTGGAGGTGAGGATGGGGG - Intergenic
1057017701 9:91667400-91667422 TTCTGAGGATGTGAGGAAATGGG - Intronic
1057058675 9:91983704-91983726 CTATGAGGATGTGGGGATTCTGG + Intergenic
1057785365 9:98083409-98083431 CTGTAAGGAAGTGAGAATGAAGG - Intronic
1057950108 9:99363120-99363142 CTGTGAAGGTGTGTGGATGGAGG + Intergenic
1058160715 9:101567757-101567779 CTGTGTGTATGTGTGCATGTGGG - Intergenic
1058285001 9:103166664-103166686 CAGTGAGGATGTGGAGAAGTGGG - Intergenic
1058743421 9:107966653-107966675 CTGCAAGGATGTGATGATGGAGG + Intergenic
1059606993 9:115844369-115844391 GTCTGAGGATCTGAGGTTGTAGG + Intergenic
1059915320 9:119093289-119093311 CTGTGGGGATGGAAGGATGGAGG + Intergenic
1060595753 9:124847647-124847669 TGGTGAGGATGTGGGGAAGTAGG - Intergenic
1060999823 9:127896825-127896847 CTGGGGGGATGGGAGGACGTAGG - Intronic
1061032979 9:128098018-128098040 CTGTGAGGATAGGAGGCTGAGGG - Intronic
1061035192 9:128109558-128109580 CTGAGAGGGTGTGAGGAGGCAGG - Intergenic
1062013468 9:134279658-134279680 GTGTGAGTGTGTGGGGATGTGGG - Intergenic
1062062707 9:134505157-134505179 CTGTGTGGATGGGTGGATGCGGG + Intergenic
1062062751 9:134505278-134505300 CTGTGTGGATGGGGGGGTGTGGG + Intergenic
1062187500 9:135225947-135225969 CTGTGAGTGTGTGAGCACGTGGG - Intergenic
1062381464 9:136288803-136288825 CTGTGAGGAAGTGGGGAGATGGG + Intronic
1186680904 X:11872890-11872912 CTGTGAGGATGTGGAGAAATTGG + Intergenic
1187281045 X:17859018-17859040 CTGTGTGTATGTGGGGGTGTGGG + Intronic
1188106546 X:26154221-26154243 ATGTGGGGATGTGGGGATGTGGG + Intergenic
1188106549 X:26154229-26154251 ATGTGGGGATGTGGGGATGTGGG + Intergenic
1188106552 X:26154237-26154259 ATGTGGGGATGTGGGGATGTGGG + Intergenic
1188106555 X:26154245-26154267 ATGTGGGGATGTGGGGATGTGGG + Intergenic
1189768807 X:44401218-44401240 TTGTGAGGGTATGAGGAGGTGGG + Intergenic
1189793948 X:44629567-44629589 GTGTGAGGAAGTGAGGTTGTTGG + Intergenic
1190106295 X:47563203-47563225 CTGTGTGTATGTGCAGATGTAGG - Intronic
1190630513 X:52381163-52381185 CTGTGAGGGTGGGAGGGTGGCGG + Intergenic
1192237025 X:69302499-69302521 CTGTGAGATTGAGAGGATGAGGG - Intergenic
1193024011 X:76824431-76824453 TGGTGAGGATGTGAGGAAATTGG - Intergenic
1193286874 X:79724086-79724108 TTTTGAGGATGTCAGGGTGTTGG - Intergenic
1194110270 X:89824827-89824849 CTGTGGGCATGTGGGGATGGAGG + Intergenic
1194184623 X:90759549-90759571 TGGTGAGGATGTGAGGAAATGGG + Intergenic
1194456251 X:94107295-94107317 CTGTCAGGAAGTGAGGAGGTGGG + Intergenic
1194804803 X:98314076-98314098 CTGTAAATATTTGAGGATGTTGG + Intergenic
1197013160 X:121591726-121591748 ATGTGATGATGTTAGGAGGTGGG + Intergenic
1197118554 X:122862943-122862965 ATGTGAGTATGTGAGTGTGTGGG - Intergenic
1197459978 X:126729223-126729245 CTGTGATGATCTGAGGAATTAGG - Intergenic
1199533216 X:148872759-148872781 ATGTGAGGATATCAGGATGAGGG - Intronic
1199952674 X:152717769-152717791 CTGGGAGGAGCTGAGTATGTTGG + Exonic
1199957009 X:152750679-152750701 CTGGGAGGAGCTGAGTATGTTGG - Intronic
1200056341 X:153463384-153463406 CAGGGAGGACTTGAGGATGTGGG - Intronic
1200462931 Y:3479568-3479590 CTGTGGGCATGTGGGGATGGAGG + Intergenic
1200531220 Y:4341551-4341573 TGGTGAGGATGTGAGGAAATGGG + Intergenic