ID: 1113883405

View in Genome Browser
Species Human (GRCh38)
Location 13:113642497-113642519
Sequence CTCATTATGATCCTTGCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113883405 Original CRISPR CTCATTATGATCCTTGCATT TGG (reversed) Intergenic
903117157 1:21187844-21187866 CTCATTATGTGCCAGGCATTAGG + Intergenic
905304462 1:37007894-37007916 CTCATGATGCTCCCTGCATTAGG - Intronic
906873621 1:49511970-49511992 CTCATGATGATCCATGCAGAGGG - Intronic
911405938 1:97439826-97439848 TTCATTTTGATACATGCATTTGG + Intronic
915694967 1:157730807-157730829 CTGTTTGTGATCCTTGCTTTTGG - Intergenic
917672299 1:177284257-177284279 ATCAATATGATACTTGCATCTGG - Intergenic
921532068 1:216296486-216296508 CTCTGTATCATCCATGCATTAGG + Intronic
921845068 1:219869813-219869835 CTGGTTTTGATCCTTGCTTTTGG - Intronic
1062969533 10:1635776-1635798 CTCATTTCGTTCCTTGCAATAGG + Intronic
1063786052 10:9384103-9384125 TTCATTAATATGCTTGCATTGGG - Intergenic
1065485058 10:26229254-26229276 CTCATTCAGTGCCTTGCATTTGG - Intronic
1067524703 10:47031255-47031277 CTCACTTTGACCCTTGTATTTGG - Intergenic
1068294452 10:55051889-55051911 CTCATTATGTTTCTGGCCTTGGG + Intronic
1071300589 10:84253406-84253428 AACATTAAGGTCCTTGCATTGGG + Intronic
1074277292 10:112015749-112015771 CTCTTTATGATCATTCCTTTTGG + Intergenic
1076272810 10:129169514-129169536 CTCATTATTATCATCGCATGGGG + Intergenic
1076353459 10:129834569-129834591 CTCATTATAGTCGGTGCATTTGG + Intergenic
1078490380 11:11762685-11762707 CCCATTCTGCTCCTTCCATTTGG - Intergenic
1079201830 11:18383364-18383386 CTCACTATCATCCTCGCATGGGG - Intergenic
1081256874 11:40907379-40907401 CCCATTATGTTCCTTGCATTTGG - Intronic
1083444523 11:62698811-62698833 CCCATTATGATCTCTGCAATGGG + Intronic
1086825222 11:91488202-91488224 CTCTTTGTGATTCTTGTATTTGG + Intergenic
1089331510 11:117692136-117692158 ATCATTAGGAACCTTGCCTTAGG - Intronic
1092308348 12:7324699-7324721 CTCGTTATGAAGCATGCATTTGG + Intronic
1093205369 12:16242378-16242400 CTCAATATCACTCTTGCATTGGG - Intronic
1094774558 12:33709454-33709476 TCCATTATGATATTTGCATTAGG + Intergenic
1101435259 12:104658822-104658844 CTCATGATGACCCTTGAAATAGG + Intronic
1106422140 13:29593548-29593570 CTCATTATCAACCATGTATTTGG - Intronic
1108567992 13:51720384-51720406 TTCCTTATCATCCTTGCCTTTGG - Intronic
1112674071 13:101677821-101677843 CTTATTATGTTTCTGGCATTTGG + Intronic
1113883405 13:113642497-113642519 CTCATTATGATCCTTGCATTTGG - Intergenic
1114838726 14:26236063-26236085 TTTATTATAATCCTTGAATTAGG + Intergenic
1114853608 14:26411121-26411143 CTCAATAGCATCCTTGCAGTAGG - Intergenic
1116963545 14:50991639-50991661 CTCATTATGACCCTTGGAGGAGG + Intronic
1120387578 14:83865336-83865358 CTCATTATGAATTTTACATTTGG + Intergenic
1123924997 15:25099912-25099934 CTCATTAGTATCTTTGGATTTGG - Intergenic
1126285440 15:47005476-47005498 TTCATTATGATACTAGCTTTGGG + Intergenic
1126457459 15:48879010-48879032 CAGATTATTTTCCTTGCATTGGG + Exonic
1126702160 15:51378104-51378126 CTCATTACCTGCCTTGCATTAGG + Intronic
1126950424 15:53874302-53874324 CTAATTATGCACATTGCATTGGG - Intergenic
1127888370 15:63224514-63224536 CTTATTTTGAACCTTGCCTTGGG + Intronic
1127970416 15:63955262-63955284 CTCAGTATGATACTAGCAGTGGG + Intronic
1133626962 16:7579571-7579593 CTCATTATGAATCTGGGATTAGG - Intronic
1135233268 16:20729650-20729672 CTCACTATGAGGCATGCATTTGG + Intronic
1137719725 16:50620902-50620924 CTCATCCTGAACCTTGCATTTGG - Intronic
1138373451 16:56545853-56545875 ATCTTCATGATCCTTCCATTTGG + Intergenic
1140673243 16:77299887-77299909 GTCATTATTAACCTTCCATTTGG - Intronic
1144173670 17:12684217-12684239 CTCATCATGATCCATGGATAAGG - Intronic
1145985431 17:29042880-29042902 CTCATTATGATCTTTGTCTCAGG - Exonic
1150533635 17:66013135-66013157 TTCCTTATAATCCTTGGATTGGG + Intronic
1151299490 17:73212452-73212474 CCCATTATCATCCTTTCATGAGG - Intronic
1151399872 17:73849027-73849049 CTCATTATTGTCCTTCCATCAGG + Intergenic
1152371994 17:79894450-79894472 CTCATTATCATTCTGGGATTGGG + Intergenic
1153483439 18:5571410-5571432 ATCCTTAGGAGCCTTGCATTTGG - Intronic
1155290859 18:24340210-24340232 ACCATTTTGATGCTTGCATTTGG - Intronic
1156768587 18:40690117-40690139 CTAACTATGACCCTTTCATTTGG - Intergenic
1159824100 18:73184683-73184705 CTGATTTTGATCTTTGCATATGG + Intronic
1168209535 19:54880464-54880486 ATCTTTAGGTTCCTTGCATTGGG + Intronic
929069447 2:38014571-38014593 GTCATTATTCTCCTAGCATTTGG - Intronic
930318713 2:49827940-49827962 CTAATTATGGTCTTTGCAATGGG + Intergenic
931096332 2:58944777-58944799 CTCATTGAGATTCTTGAATTTGG + Intergenic
931801407 2:65761655-65761677 CCCATTATGAGCCTTGCTTTGGG - Intergenic
935923451 2:108040546-108040568 CTCATAATGTGCCTGGCATTGGG - Intergenic
937392387 2:121501119-121501141 CTCATTATAGTGCTGGCATTGGG - Intronic
937706241 2:124924057-124924079 CTCTTTTTCATCCCTGCATTTGG + Intergenic
939254081 2:139720146-139720168 TTCCTTATGATCTCTGCATTTGG - Intergenic
940129721 2:150367525-150367547 CACAATATGATCCCTGCTTTAGG + Intergenic
940207444 2:151219427-151219449 CTAAGTATGATCCTTGCTGTGGG + Intergenic
940307748 2:152244717-152244739 CTCAATATGATCATTTAATTTGG - Intergenic
940884433 2:158976363-158976385 CTCATTCTTATTCTTGCCTTTGG + Intronic
941943209 2:171066057-171066079 CTCAAAATCATCCTTGAATTCGG - Intronic
945412745 2:209531844-209531866 CTCAATAAGATCCTTCCCTTAGG - Intronic
946444877 2:219729739-219729761 CTCATTTTGTTCTTTGCATAGGG + Intergenic
948271907 2:236680839-236680861 ATTATAATGATCCTTGGATTGGG + Intergenic
1177785343 21:25665439-25665461 TTCATTATGATGCTTGTATTAGG + Intronic
1184902692 22:47457472-47457494 CTCACTGGGATCCTGGCATTAGG + Intergenic
951099925 3:18675685-18675707 CTCAAGATGAGCCCTGCATTTGG + Intergenic
951434656 3:22647889-22647911 CTCATTATGATACTAGCTGTGGG + Intergenic
951688071 3:25366806-25366828 CTAAATATTATCCTTGCATTTGG + Intronic
952197133 3:31087738-31087760 CTCATTTTGCTCCATTCATTTGG - Intergenic
952734811 3:36678656-36678678 TTCTTTATGTTTCTTGCATTTGG - Intergenic
952986612 3:38791252-38791274 GTCATTAGGATCTTTCCATTAGG + Intronic
953677205 3:45012313-45012335 CACATTATGTTCTTTCCATTTGG - Intronic
954329416 3:49881589-49881611 CTCTTTCTGATCCTAGCTTTTGG - Intergenic
955514561 3:59713862-59713884 CTCATTATGACCCCTCCATCTGG - Intergenic
955634895 3:61016959-61016981 CTCATTACTACTCTTGCATTAGG - Intronic
956592193 3:70926582-70926604 CTCATTATGTACCAGGCATTAGG - Intergenic
958480646 3:94642283-94642305 TTCTTTCTGATCCTTGTATTTGG + Intergenic
959017536 3:101152675-101152697 CTCATCATTATCCCTTCATTTGG - Intergenic
959134858 3:102405147-102405169 CTTATTATGACTCTTGCTTTGGG - Intronic
960846374 3:122007765-122007787 CTAATTATGATTCGTGCCTTGGG + Intronic
962515088 3:136142707-136142729 ATCATTATAATCCTAGCATTTGG + Intronic
970865555 4:20755055-20755077 CTCATTATAATCCTGGCATCAGG + Intronic
970885536 4:20984116-20984138 CTCATGCTGATCCTGGCATTTGG + Intronic
972267475 4:37476253-37476275 ATCATTTTTATCCTTCCATTTGG - Intronic
972804652 4:42516413-42516435 CTTATTATGATGCGTGGATTGGG - Intronic
973301128 4:48585948-48585970 ATCATTATGATCTTTGTAATGGG - Intronic
974124883 4:57683900-57683922 CTTATTATGCTTATTGCATTGGG + Intergenic
975390839 4:73815524-73815546 CTCTTTATAATCCAAGCATTTGG + Intergenic
976672449 4:87668605-87668627 CACGTTATGATCCAGGCATTAGG + Intergenic
977131031 4:93237343-93237365 CTCATCATGAACTTTGCATCAGG + Intronic
977266417 4:94861417-94861439 CTCAGTATGATGTTTGTATTTGG + Intronic
977953867 4:103004165-103004187 TTCCTTAGAATCCTTGCATTGGG - Intronic
980532973 4:134078596-134078618 CTCATTATAGTCCTAGAATTAGG + Intergenic
982536394 4:156611836-156611858 CTCTTTATGATCATTTCGTTTGG + Intergenic
982819310 4:159926702-159926724 CTCTTTCAGATGCTTGCATTTGG + Intergenic
983901135 4:173135706-173135728 CTCATAATTATCCTTGGTTTGGG + Intergenic
984144635 4:176045556-176045578 CTGATTCTGATGCTTGCATGTGG - Intergenic
985848171 5:2369674-2369696 CTCATTATCAACCTGGCATCTGG - Intergenic
990432969 5:55755270-55755292 ATAATTATGATGTTTGCATTAGG + Intronic
991518060 5:67461734-67461756 CTCATTTTTATCCTTTCCTTGGG - Intergenic
993401111 5:87452782-87452804 GTCATAATGATGCTTGTATTTGG + Intergenic
994057534 5:95435194-95435216 CCAATTATGCTCCTTGCAGTAGG + Intronic
996003715 5:118394610-118394632 CTCATGATGATTCTTTCAATGGG + Intergenic
998410747 5:141909426-141909448 ATCATCATGATGCTAGCATTTGG + Intergenic
1001080325 5:168662949-168662971 TTCTTAATGGTCCTTGCATTTGG + Intronic
1004016849 6:11739389-11739411 CTCTTTATAACCGTTGCATTTGG - Intronic
1005274329 6:24199738-24199760 CTTATTAGCTTCCTTGCATTGGG - Intronic
1005382260 6:25248139-25248161 ATTTTTTTGATCCTTGCATTGGG - Intergenic
1007734305 6:43971075-43971097 CTCATTCTGAGCCTTGAAGTAGG + Intergenic
1008436742 6:51485284-51485306 GTTTTTATGATCCTTGCAATGGG + Intergenic
1009604163 6:65845511-65845533 CTAATTATGATCCTTGAAAAAGG + Intergenic
1011404554 6:87004621-87004643 CTCATTATGATACTAGCTGTGGG - Intronic
1011504483 6:88027264-88027286 CTCTGTATGATACTTGCATTAGG + Intergenic
1012139805 6:95611897-95611919 CTAATTATGATACTTGCTGTAGG - Intergenic
1012696175 6:102386805-102386827 CTCATTATGAATTTTCCATTAGG + Intergenic
1015060443 6:128958571-128958593 CTCATCATCATCCTTACAATAGG + Intronic
1015335098 6:132027821-132027843 CACATTATGTTCCTTGCAGCGGG + Intergenic
1015375716 6:132508046-132508068 CTCATTTTGATTCTGGCAGTGGG - Intronic
1015424631 6:133051384-133051406 TTCATTATTAGCCTTTCATTTGG + Intergenic
1021157454 7:17229451-17229473 TTCATTATGATCTTTCCTTTGGG + Intergenic
1022308154 7:29170046-29170068 GTCCTTTTGATCCTTGTATTTGG + Intronic
1022975958 7:35557222-35557244 CTCTTCATGATCCTGGCCTTTGG + Intergenic
1028046371 7:86125566-86125588 ATCATGATGATGCATGCATTTGG + Intergenic
1028700753 7:93776228-93776250 CTCATTGTGTTCCTGGCATCTGG + Intronic
1029052452 7:97702999-97703021 TTCATTGTGATTCTTGGATTGGG - Intergenic
1030609388 7:111672113-111672135 CTCATTATCATTTGTGCATTTGG - Intergenic
1033963541 7:146945121-146945143 CTCATTGTGATCATTGCAATGGG + Intronic
1034016178 7:147589310-147589332 CTGATTATAATCCTTGGCTTGGG + Intronic
1036134205 8:6144237-6144259 CTGATTTTGATGGTTGCATTGGG + Intergenic
1041859334 8:62494136-62494158 TTCATTATGATGCTTGCTGTGGG + Intronic
1042013441 8:64277886-64277908 CTCATAATAATCCTTCTATTTGG + Intergenic
1043171178 8:76968536-76968558 GTCCTTATGTTCCTGGCATTGGG + Intergenic
1043297795 8:78686594-78686616 CTTCTTATGATCCTGGTATTTGG + Exonic
1044871506 8:96624824-96624846 CTCATTATGTTCCTTGGTATTGG + Intergenic
1049038175 8:140093008-140093030 TTCATTCAGATACTTGCATTAGG - Intronic
1049982810 9:920389-920411 CTCATTAAAATCCTTTAATTTGG - Intronic
1055061568 9:72073729-72073751 CTCGTTAACTTCCTTGCATTGGG - Intergenic
1055917449 9:81419895-81419917 CTCATTAAACTCCTTGCCTTAGG - Intergenic
1058400403 9:104610834-104610856 GTCATTATCATCCTTCCATGAGG + Intergenic
1186662851 X:11686873-11686895 CTCATTCTGTACCTTGCTTTAGG - Intergenic
1187684347 X:21801290-21801312 CCCTTTATTTTCCTTGCATTTGG + Intergenic
1188526793 X:31095917-31095939 CTCATTATAATCCCTCCCTTTGG + Intergenic
1197684234 X:129421733-129421755 CTCATTATGATCTTGGCTGTGGG + Intergenic
1199164858 X:144659746-144659768 CTCATTATGATGATTACTTTTGG - Intergenic
1200764690 Y:7070560-7070582 CTCCTTGTCATCTTTGCATTTGG - Intronic