ID: 1113883862

View in Genome Browser
Species Human (GRCh38)
Location 13:113647159-113647181
Sequence CGGGCACGGGGGTGCCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 232}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113883853_1113883862 6 Left 1113883853 13:113647130-113647152 CCCCGGCTTTATCAGGAAGGGGC 0: 1
1: 0
2: 0
3: 3
4: 111
Right 1113883862 13:113647159-113647181 CGGGCACGGGGGTGCCCCTGTGG 0: 1
1: 0
2: 0
3: 17
4: 232
1113883855_1113883862 4 Left 1113883855 13:113647132-113647154 CCGGCTTTATCAGGAAGGGGCTC 0: 1
1: 0
2: 0
3: 6
4: 123
Right 1113883862 13:113647159-113647181 CGGGCACGGGGGTGCCCCTGTGG 0: 1
1: 0
2: 0
3: 17
4: 232
1113883854_1113883862 5 Left 1113883854 13:113647131-113647153 CCCGGCTTTATCAGGAAGGGGCT 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1113883862 13:113647159-113647181 CGGGCACGGGGGTGCCCCTGTGG 0: 1
1: 0
2: 0
3: 17
4: 232
1113883851_1113883862 7 Left 1113883851 13:113647129-113647151 CCCCCGGCTTTATCAGGAAGGGG 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1113883862 13:113647159-113647181 CGGGCACGGGGGTGCCCCTGTGG 0: 1
1: 0
2: 0
3: 17
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113883862 Original CRISPR CGGGCACGGGGGTGCCCCTG TGG Intergenic