ID: 1113883930

View in Genome Browser
Species Human (GRCh38)
Location 13:113647447-113647469
Sequence CATGCCATGCTGAAGGTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113883930_1113883933 -2 Left 1113883930 13:113647447-113647469 CCTCTGACCTTCAGCATGGCATG 0: 1
1: 0
2: 0
3: 14
4: 236
Right 1113883933 13:113647468-113647490 TGACCTCGCTGAGGTGACCCTGG 0: 1
1: 0
2: 0
3: 7
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113883930 Original CRISPR CATGCCATGCTGAAGGTCAG AGG (reversed) Intergenic
900977936 1:6028728-6028750 GAGGCCATCCTGGAGGTCAGTGG - Intronic
901321538 1:8343236-8343258 CATGCCATGCTGGGGGACAGTGG - Intronic
901379764 1:8865228-8865250 GCTGCCCTGCTGCAGGTCAGTGG + Intronic
902221137 1:14966540-14966562 GATACCATGCTGAAATTCAGTGG + Intronic
902621546 1:17653807-17653829 GATGCCAACTTGAAGGTCAGAGG - Intronic
902830363 1:19008442-19008464 CACCCCAGCCTGAAGGTCAGGGG - Intergenic
903971605 1:27122574-27122596 AGGGCCAGGCTGAAGGTCAGGGG - Intronic
904421592 1:30397962-30397984 CATTCCAGGCAGAAGGTGAGGGG + Intergenic
904635824 1:31880305-31880327 AATGCCTTGTTGAAGATCAGTGG - Intergenic
905126701 1:35720406-35720428 CACCCCAGGCTGAAGGCCAGGGG - Intronic
906515782 1:46438119-46438141 CATGCCATGCTGAGGCGCTGAGG + Intergenic
906946597 1:50300071-50300093 ACTGGCATGCTGGAGGTCAGAGG + Intergenic
907514633 1:54985905-54985927 CGGGCTATTCTGAAGGTCAGAGG - Intronic
907707595 1:56846085-56846107 CATGGCATGGTGATGGGCAGGGG + Intergenic
908457733 1:64320697-64320719 CATGCCATGAGGATGCTCAGTGG + Intergenic
910409694 1:86927289-86927311 CATGCCACGTTGAAGATCTGAGG - Intronic
917482833 1:175427082-175427104 CATGGCATTGTGCAGGTCAGTGG - Intronic
917965567 1:180176417-180176439 CATGCCATTCTGACTCTCAGTGG - Intronic
918244539 1:182647231-182647253 CCTGCCATGGTGAAGGTCCCTGG - Intronic
918974163 1:191460179-191460201 CATGTCATGCAGAATCTCAGAGG - Intergenic
920949734 1:210561155-210561177 GAGGCCATGATGAAGGTCAAGGG - Intronic
921719448 1:218454235-218454257 CTTGCCAGGCTGAAGTGCAGTGG - Intergenic
1063002184 10:1934847-1934869 CGTGCCAGGCGGAGGGTCAGCGG + Intergenic
1064737166 10:18393978-18394000 GTTGCCAGGCTGAAGTTCAGTGG + Intronic
1065089828 10:22220510-22220532 TTTGCCAGGCTGAAGTTCAGTGG - Intergenic
1065249945 10:23800659-23800681 CTTCCCTTGATGAAGGTCAGTGG + Intronic
1066328771 10:34394363-34394385 CATGCCAAGCTGGAGTACAGTGG + Intronic
1066543250 10:36472047-36472069 CATGTTTTGCTGAAGCTCAGAGG + Intergenic
1067802453 10:49368425-49368447 CATGACAGGCTGGAGGCCAGCGG - Intronic
1068091816 10:52441206-52441228 CATCCCATGCTGAAGTTGAGGGG - Intergenic
1068893536 10:62174186-62174208 GATGCCAGGCTGAAGTGCAGTGG + Intergenic
1069530098 10:69211427-69211449 CATCCCATGTTTAAGTTCAGTGG - Intergenic
1070115211 10:73522061-73522083 CATGTCCTGCTGGAGGTAAGTGG - Intronic
1072571903 10:96665735-96665757 CATGCTATGCTAAATGTCAGAGG + Intronic
1073422978 10:103439300-103439322 CCTCCCAGGCTGGAGGTCAGAGG - Intronic
1074043949 10:109819782-109819804 CTTGCCGTGTTGAGGGTCAGAGG - Intergenic
1074384065 10:113003406-113003428 CAAGCCATGCTGAGGCTCTGGGG - Intronic
1075392815 10:122105260-122105282 TATGTGATGCGGAAGGTCAGAGG - Intronic
1075928640 10:126274163-126274185 CATGACATCCTTACGGTCAGGGG - Intronic
1076252560 10:128995813-128995835 CAGGCCATCCTGGAGGCCAGAGG + Intergenic
1076314693 10:129532185-129532207 CATGCCATGATGCTGGTCATGGG + Intronic
1080944516 11:36956533-36956555 CATGGGATGCTGAAGGTGGGAGG + Intergenic
1081563319 11:44239430-44239452 CTTGCCAGGCTGGAGTTCAGTGG + Intronic
1083453143 11:62760036-62760058 CATCCCAGGCTGAAGTGCAGTGG + Intergenic
1084006623 11:66326677-66326699 CAGGCCAGGCTGATGCTCAGAGG - Intergenic
1085190104 11:74612931-74612953 AAAGCCATGCTAAAGGACAGTGG + Exonic
1086755341 11:90554806-90554828 CAGGACATGCTGAAAGCCAGTGG - Intergenic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1096478245 12:51921626-51921648 CATGGCAGGGGGAAGGTCAGTGG + Intronic
1097653354 12:62331103-62331125 CATGCCATCTTGAAGGCCAGGGG - Intronic
1098170406 12:67741245-67741267 CATGCCTTGCTGAAGGAGAGAGG + Intergenic
1101522019 12:105492855-105492877 CATGCAATGGGGAAGGTGAGTGG - Intergenic
1102884527 12:116511506-116511528 CGTGCCCTGCTGAAAGTCAAGGG - Intergenic
1104094448 12:125544236-125544258 CATGCCAGGCTTAAGGTGATGGG + Intronic
1106106343 13:26736704-26736726 CATGCCATGCTGGTGGTTAGAGG + Intergenic
1107298912 13:38945568-38945590 CATTACCTGCTGCAGGTCAGAGG + Intergenic
1107583577 13:41819069-41819091 CATACAGTGGTGAAGGTCAGTGG - Intronic
1111190434 13:84799952-84799974 CCTGCGCTGCTGAAGCTCAGGGG + Intergenic
1111615133 13:90652838-90652860 CATGCAATTCTGAAATTCAGTGG - Intergenic
1113883930 13:113647447-113647469 CATGCCATGCTGAAGGTCAGAGG - Intergenic
1115199799 14:30840748-30840770 CAGGCCATGCTGAAGTCCAAGGG - Intergenic
1117463505 14:55970354-55970376 AATGCCATTGTGAGGGTCAGAGG + Intergenic
1117861076 14:60093053-60093075 GATGCTATGCTAAAGGTCTGGGG - Intronic
1121778238 14:96605032-96605054 CATGCCACGTTCAAGGTTAGTGG - Intergenic
1122210918 14:100173524-100173546 CAGGCCAGGCTGGAGGGCAGGGG - Intergenic
1122883698 14:104701216-104701238 CGTGCCATGCTGAGGGTTAGGGG - Intronic
1123519624 15:21059974-21059996 TTTCCCAGGCTGAAGGTCAGTGG + Intergenic
1123972617 15:25522562-25522584 CATGCCAGGCTGGAGTGCAGTGG - Intergenic
1126437856 15:48654216-48654238 CAGGCCATGCTCAAGGGGAGGGG - Intergenic
1127377474 15:58398203-58398225 CATGCAAGGCTGAAAGTCAAGGG - Intronic
1130918485 15:88324424-88324446 CAGGCCATGCTGAAGGGAGGGGG + Intergenic
1131697198 15:94890638-94890660 CAAGCCTTGCTGAAGGTTTGAGG + Intergenic
1131713423 15:95080651-95080673 CTTGCCAGGCTGAAGTGCAGTGG + Intergenic
1132936527 16:2484061-2484083 CCTCCCATGCAGAATGTCAGGGG - Intronic
1132947620 16:2540607-2540629 CATGCCGTGCTGGAGGTAGGAGG + Intronic
1132968119 16:2671016-2671038 CATGCCGTGCTGGAGGTAGGAGG - Intergenic
1133062912 16:3186903-3186925 CCTGTCAGGCTGAAGGGCAGTGG + Intergenic
1133229659 16:4360532-4360554 CAGGCCAGGCTGAAGATCTGGGG + Exonic
1133632526 16:7635019-7635041 CATTCCATTCCGAAGGCCAGTGG + Intronic
1139869687 16:70096750-70096772 GTTGCCAGGCTGAAGGGCAGTGG - Intergenic
1140066210 16:71613538-71613560 CATGCGTTGCTTAATGTCAGGGG + Intergenic
1140385696 16:74535470-74535492 GTTGCCAGGCTGAAGGGCAGTGG + Intronic
1140968853 16:79993695-79993717 TATGCCCTGCTGTAGGACAGAGG - Intergenic
1141395708 16:83702657-83702679 CATGAGATGCTCAAGGTCGGTGG + Intronic
1141506143 16:84479962-84479984 CAGGCCCTGCTGGAGATCAGTGG - Exonic
1143525065 17:7467042-7467064 CAGGTCATGGTGAAGGTCAAGGG + Intronic
1144222313 17:13111358-13111380 CTTGCCAGGCTGGAGGGCAGTGG + Intergenic
1149468637 17:56898923-56898945 CGTGCAATGCTGATGGACAGCGG + Intronic
1151432546 17:74073488-74073510 CATCCCATGCTCAAGGCAAGAGG - Intergenic
1153037520 18:778161-778183 CATGCCTTGCTCAAGGACAGGGG + Intronic
1153706226 18:7748418-7748440 CATCCCACGCAGAAGGACAGAGG - Intronic
1156867552 18:41905689-41905711 GACGCCATCCTGAAGGCCAGAGG + Intergenic
1158480608 18:57818312-57818334 CCTTCCAGGCTGCAGGTCAGTGG + Intergenic
1158634695 18:59146519-59146541 CATGCCATCCTGGAAGGCAGGGG + Intronic
1159527807 18:69616312-69616334 CATGGCATGGTGGAGGTGAGGGG - Intronic
1160472815 18:79153688-79153710 CTTGCCAGGCTGAAGTGCAGTGG + Intronic
1160893320 19:1390883-1390905 CAGGCCAGGCCGAAGGTCATGGG - Exonic
1161942779 19:7416030-7416052 CATGCCCTGTTGAAGGTCTATGG + Intronic
1164566653 19:29330559-29330581 CATCCCCTGCTGAAGGTCACTGG + Intergenic
1168646183 19:58060384-58060406 CACGCCGCGCTGGAGGTCAGCGG + Intronic
925131837 2:1499252-1499274 CGTCCCAGGCGGAAGGTCAGAGG - Intronic
925297276 2:2785832-2785854 CATCCCATGCAGACGCTCAGTGG + Intergenic
925297284 2:2785872-2785894 CATTCCATGCAGATGCTCAGTGG + Intergenic
925299322 2:2799344-2799366 CAGGCCAGGCTGCAGGACAGAGG + Intergenic
925458296 2:4037960-4037982 AAAGCCATTCTGTAGGTCAGGGG + Intergenic
926207068 2:10841352-10841374 CATCCCCTCCTGAAGGTCTGGGG - Intergenic
927262212 2:21102862-21102884 CATCCCATGCTGAACTCCAGGGG - Intergenic
927640784 2:24844169-24844191 CACTCCACCCTGAAGGTCAGCGG - Intronic
928293432 2:30060562-30060584 CATGCCATGCTGCAGGGGAATGG - Intergenic
928302355 2:30137079-30137101 AATGCGAAACTGAAGGTCAGGGG + Intergenic
931317811 2:61149165-61149187 CAAGCCATGCTTGAAGTCAGAGG - Intronic
932716550 2:74104352-74104374 CTTGTCAAACTGAAGGTCAGAGG - Exonic
933558724 2:83865039-83865061 TATGCAATTCTGAAGGTGAGTGG + Intergenic
935067461 2:99662098-99662120 GTTGCCAGGCTGAAGTTCAGTGG - Intronic
935156598 2:100488695-100488717 CATGCCATGCAGAGGGGTAGAGG - Intergenic
935709842 2:105888626-105888648 CAGCCCATGCTGAAGGGAAGAGG - Intronic
936041760 2:109155180-109155202 CTTGCTATGCTGATGTTCAGTGG + Intronic
936637360 2:114273863-114273885 CTTGGAATGGTGAAGGTCAGAGG + Intergenic
938047115 2:128131665-128131687 CTTGCCAGGCTGAAGTGCAGTGG + Intronic
940302269 2:152187540-152187562 GTTGCCAGGCTGAAGGGCAGTGG + Intergenic
942012539 2:171777139-171777161 CCAGCCATGCTGAAGTGCAGAGG - Intergenic
942651672 2:178175328-178175350 CATTCTATGTTTAAGGTCAGTGG + Intergenic
943642112 2:190371163-190371185 CATGCCATACTGAGGGCCATGGG + Exonic
944332096 2:198481834-198481856 CAGACCATGCTGCAGGTCTGGGG + Intronic
944443548 2:199766405-199766427 GAAACCATGCTGAAGGACAGTGG - Intronic
947824713 2:233097843-233097865 CGTGCAATGCTGCAGATCAGTGG + Intronic
947942724 2:234072641-234072663 CCTGCCCTGCTAAAGGTCATGGG - Intronic
1168762976 20:362369-362391 CATGCCATGTCCAAGGTCACAGG - Intergenic
1170548706 20:17456985-17457007 CCTTCCAAGCTGAAGGTAAGAGG + Intronic
1170571629 20:17636040-17636062 CAGGACGTGCTGGAGGTCAGAGG - Intronic
1172312333 20:33928337-33928359 CAAGCCAGGCTACAGGTCAGAGG - Intergenic
1173337688 20:42126098-42126120 CAGGCCATGCAGCTGGTCAGTGG - Intronic
1173647234 20:44641075-44641097 CAGGCCCTGCTGGAGGTCACAGG + Intronic
1174174652 20:48637149-48637171 CATGCCAAGGTCAAGGACAGGGG - Intronic
1176907206 21:14516429-14516451 GTTGCCAGGCTGAAGTTCAGTGG + Intronic
1177447337 21:21215040-21215062 CATGAAATATTGAAGGTCAGAGG + Intronic
1177815776 21:25974909-25974931 CATTCCATCTTGAAGGTCAAAGG - Intronic
1178538859 21:33432717-33432739 GATGACTTGCTGAAGCTCAGTGG - Exonic
1179273499 21:39869598-39869620 GTGGCCATGCTGATGGTCAGAGG - Intronic
1179730356 21:43364127-43364149 CCAGCCCTGCTGATGGTCAGCGG + Intergenic
1180021037 21:45127182-45127204 GAGGCAACGCTGAAGGTCAGAGG + Intronic
1181369098 22:22402482-22402504 GTTGCCAGGCTGAAGTTCAGTGG + Intergenic
1182710910 22:32322719-32322741 CATGCCATGCACAAGCCCAGGGG - Intergenic
1183004953 22:34893549-34893571 CAGCCCATGCTGCAGGTAAGGGG + Intergenic
1184023470 22:41836482-41836504 TTGGGCATGCTGAAGGTCAGTGG + Intronic
1184166128 22:42729100-42729122 CATGCCAGGCTGGAGTGCAGTGG - Intergenic
1184398451 22:44259588-44259610 CATGCCATGCACAAGCCCAGGGG - Intronic
1184602388 22:45551383-45551405 CAAGGCAGGCTGAAGGTCAAGGG - Intronic
1185367685 22:50444445-50444467 CGTGCCCTGCTGGAGGACAGAGG + Intronic
950405483 3:12801710-12801732 CACGCCATGCTGATGGGCATGGG - Intronic
950808089 3:15625593-15625615 CATGCCAGGCTGGAGTGCAGTGG + Intronic
950973054 3:17209185-17209207 CATCCCATGCTGGAGTGCAGTGG + Intronic
951419018 3:22461919-22461941 CAGGCTATGCTCAAGGTCAGAGG + Intergenic
953607148 3:44419518-44419540 CAGGCCAGGCTGGAGGGCAGAGG - Intergenic
953637151 3:44673091-44673113 CAAGCCATGCAGAAGGTGAGAGG + Intergenic
954394015 3:50283143-50283165 CTTGCCATGCTGGAGTGCAGTGG - Intronic
955289344 3:57676338-57676360 TTTGCCAGGCTGAAGGGCAGTGG - Intronic
961724308 3:128916025-128916047 CATGCCTGCCTGGAGGTCAGTGG - Intronic
962598818 3:136975376-136975398 CTTGCCAGGCTGAAGTGCAGTGG + Intronic
963043509 3:141085969-141085991 CAAGCCCTGCTGAAGGGCAATGG - Intronic
966230645 3:177647953-177647975 GATGCCAAGCTGTAGGTCAAAGG - Intergenic
968675881 4:1879115-1879137 CATGCCATGCTCAAGATCTAGGG - Intronic
969245794 4:5931945-5931967 CAAGCCACGCAGAAGGGCAGAGG + Intronic
969479490 4:7440473-7440495 CCTGCCATGCAGAAGGGAAGGGG + Intronic
972220546 4:36949790-36949812 CATGCAATTCTGAAATTCAGTGG + Intergenic
973218282 4:47696671-47696693 CATGTCATTCTGAAGTCCAGGGG - Intronic
975657031 4:76651903-76651925 CATGGCAGGCTGAAGTGCAGGGG - Intronic
977148436 4:93477106-93477128 CATCCCATGGTGGAGGGCAGAGG + Intronic
977756921 4:100682672-100682694 CATGCCAACCTGCAGGCCAGCGG + Intronic
978807761 4:112818394-112818416 CATGCCATTCTGGAGTTCAAAGG + Intronic
981129405 4:141141774-141141796 CAGGCCAGGCTGAAGTGCAGTGG - Intronic
981416760 4:144502922-144502944 GATGCCATGCTGAAGCCAAGGGG - Intergenic
981980098 4:150781509-150781531 CAGGCCATGCAGGAGGTGAGCGG - Intronic
982077229 4:151749919-151749941 CATGCCAGGCTGGAGTGCAGTGG + Intronic
985182728 4:187282323-187282345 CATGCCAGCCTGAATGACAGAGG + Intergenic
986553245 5:8982251-8982273 CATTCCATGCAAAAGCTCAGAGG - Intergenic
990425356 5:55682733-55682755 CATGCCATGCTGGAGTGCAGTGG - Intronic
990531864 5:56682192-56682214 CATGCTATGTTAAAGTTCAGTGG - Intergenic
991226630 5:64280925-64280947 CATCCCATGCTCATGGACAGGGG - Intronic
993401316 5:87456087-87456109 CATGCCAGGCTGGAGTGCAGTGG + Intergenic
993747370 5:91617650-91617672 AATGCCATTCTGAAGGGAAGTGG - Intergenic
995538060 5:113157247-113157269 CCTGGCGTGATGAAGGTCAGAGG - Intronic
996208956 5:120781008-120781030 GTTGCCAGGCTGAAGGGCAGTGG - Intergenic
999170268 5:149588334-149588356 CATGCCAGGCTGGAGTGCAGTGG + Intronic
999207939 5:149863463-149863485 CACTTCATGCTGAAGGACAGGGG - Intronic
1000451792 5:161398727-161398749 GTTGCCAGGCTGAAGTTCAGTGG + Intronic
1001285030 5:170416469-170416491 CAAACCATGCTGGAGGTCAGGGG + Intronic
1003558105 6:7158486-7158508 CAGGTCCTGCTGAAGGGCAGGGG - Intronic
1005054043 6:21712865-21712887 CCTGCCATGCTCTAGGTGAGGGG + Intergenic
1005497846 6:26404380-26404402 CATGCTAATCTGAAGATCAGAGG - Intronic
1005519264 6:26584341-26584363 ATTGACATGGTGAAGGTCAGGGG + Intergenic
1007252866 6:40508243-40508265 CAGGACATGCTGCAGGTAAGGGG + Intronic
1007336558 6:41158951-41158973 CATGCCAGGCTGCAGCCCAGAGG + Exonic
1007715504 6:43853356-43853378 CCTGCCATGCTTTAGGCCAGAGG + Intergenic
1011881647 6:92035148-92035170 CATACCCTTCTGAAGGTCATGGG + Intergenic
1011975817 6:93296708-93296730 AATGGCATGATGCAGGTCAGAGG + Intronic
1012137751 6:95579331-95579353 GTTGCCATGCTGAAGTGCAGTGG - Intronic
1014080726 6:117283159-117283181 CATTGCATTCTGAAGGTCAAGGG - Intergenic
1015642981 6:135356976-135356998 GATGCCAGGCTGAAGTGCAGTGG + Intronic
1015773149 6:136789426-136789448 CATGCCATCCAGATGGGCAGGGG + Intronic
1016378062 6:143444300-143444322 CCTGCCATGCTGAGGATGAGTGG + Intronic
1016452297 6:144195568-144195590 CAGGCCAGGCTGGAGGACAGTGG - Intergenic
1018782092 6:167077332-167077354 CAAGCCATTCTGGAGGTCACTGG - Intergenic
1019444947 7:1066397-1066419 CGGGCCATGCTGAGGGACAGGGG + Intronic
1019472931 7:1230748-1230770 CACGCCAATCTGAAGGCCAGGGG + Intergenic
1024026361 7:45413209-45413231 AATGCCATGCACAAGGTCCGTGG - Intergenic
1024633700 7:51269408-51269430 CATGCCGTGCTGCTGGTAAGTGG + Intronic
1025152978 7:56574888-56574910 CATTCAATGCTGAAGATCTGTGG + Intergenic
1025753076 7:64310673-64310695 CATGCCATGATGAATCTTAGGGG - Intronic
1029144664 7:98437210-98437232 CATGACCTGCTGAAGGTGACAGG + Intergenic
1032544427 7:132729842-132729864 CCTCCCATCCTGGAGGTCAGGGG - Intergenic
1032785482 7:135196559-135196581 CAGGCCCTGCTGAAGGAGAGGGG + Intronic
1033601645 7:142893018-142893040 CCTGTCATTCGGAAGGTCAGAGG - Intergenic
1035415527 7:158681133-158681155 CATTTTATCCTGAAGGTCAGAGG - Intronic
1035867422 8:3100089-3100111 CAAGCCAGGCTGGAGGGCAGTGG + Intronic
1038415924 8:27395854-27395876 GATTCCTTGTTGAAGGTCAGGGG + Intronic
1038536432 8:28356517-28356539 CATGGCATGCAGCCGGTCAGAGG + Intronic
1039506349 8:38055162-38055184 CGTGAGATGCTGAAGGGCAGAGG - Intronic
1041988155 8:63952241-63952263 CTTGCCATGCTGAGGGGAAGTGG + Intergenic
1044356834 8:91232555-91232577 CATGTCTTGCTGAATTTCAGAGG + Intronic
1044701374 8:94968228-94968250 CAGGCCACGCTGAAGGGGAGGGG + Intronic
1044722941 8:95168414-95168436 AATGCCATCCTCAAAGTCAGAGG + Intergenic
1047906051 8:129474320-129474342 CAGCCCATGCTGAAGTCCAGAGG - Intergenic
1047981373 8:130186636-130186658 CATGCTATGCTGAGGCTCTGTGG + Intronic
1049158902 8:141084783-141084805 CAGGCCACGCTGAAGGTGGGCGG + Intergenic
1049289723 8:141795373-141795395 CCTCCCATGCTGAGGGTCTGAGG - Intergenic
1049309209 8:141924440-141924462 CAGGCCATGGTGCAGGGCAGCGG - Intergenic
1050524786 9:6536258-6536280 CTTGCCTCACTGAAGGTCAGTGG + Intronic
1051159040 9:14185100-14185122 TATGCCATGTAGAAGCTCAGAGG + Intronic
1051938607 9:22475314-22475336 TATGTTATGCTGAAGGTGAGAGG - Intergenic
1052989177 9:34508657-34508679 CAAGCCAAGCAGAAGGGCAGAGG + Intronic
1056797751 9:89670287-89670309 CAGCCCATGCTCAGGGTCAGGGG + Intergenic
1059651334 9:116318878-116318900 CAGGCCCTGCTGAGGGTCGGCGG - Intronic
1059674150 9:116521355-116521377 TTTGCTTTGCTGAAGGTCAGTGG - Intronic
1059911280 9:119046839-119046861 GAGGCAAGGCTGAAGGTCAGAGG - Intergenic
1060305002 9:122403442-122403464 CACTCCATCCTGAAGGTCAGTGG + Intergenic
1060427861 9:123521593-123521615 CCTTCCATGCGGAAGGACAGGGG + Intronic
1060444583 9:123676329-123676351 CATGTCATGCTGCAGATCTGGGG - Intronic
1060871719 9:127047964-127047986 AGTGCCATGCTGAAGGACATGGG - Intronic
1061960311 9:133984872-133984894 CATTCCAGCCTGAAGGACAGAGG + Intronic
1062025896 9:134340541-134340563 CCTGCCACGCTGTAGGCCAGAGG - Intronic
1062423738 9:136496701-136496723 CATGCCATGCTGCAGGGAGGGGG + Exonic
1062563847 9:137154938-137154960 TATGACAGGCTGAAGGTCTGGGG - Intronic
1188199554 X:27282165-27282187 CACGCCATGCTGAGGGTCCCAGG - Intergenic
1189750297 X:44213809-44213831 CAGGCCATGATGAGGGGCAGGGG - Intronic
1191789930 X:64958962-64958984 CATGCCCAGCTGAAAATCAGAGG - Intronic
1196717121 X:118822981-118823003 CTTGCCAGGCTGAAGTGCAGCGG + Intergenic
1196881901 X:120206461-120206483 CAGCCCATGCTGAAGTCCAGAGG - Intergenic
1199280288 X:145992958-145992980 CATGCCAAGTTGGAGGGCAGTGG - Intergenic
1199280475 X:145994482-145994504 CATGCCAAGTTGGAGGGCAGTGG - Intergenic
1200835206 Y:7725829-7725851 CATGCGATGGTGAAGGTGAAAGG - Intergenic