ID: 1113884748

View in Genome Browser
Species Human (GRCh38)
Location 13:113652576-113652598
Sequence GGCATCTCTGGCTGCCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 243}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113884737_1113884748 14 Left 1113884737 13:113652539-113652561 CCTGACTCCAGAACTTGAGGCCC 0: 1
1: 0
2: 2
3: 15
4: 158
Right 1113884748 13:113652576-113652598 GGCATCTCTGGCTGCCCTGAAGG 0: 1
1: 0
2: 2
3: 21
4: 243
1113884733_1113884748 23 Left 1113884733 13:113652530-113652552 CCTCCCAATCCTGACTCCAGAAC 0: 1
1: 0
2: 0
3: 17
4: 184
Right 1113884748 13:113652576-113652598 GGCATCTCTGGCTGCCCTGAAGG 0: 1
1: 0
2: 2
3: 21
4: 243
1113884738_1113884748 7 Left 1113884738 13:113652546-113652568 CCAGAACTTGAGGCCCCTTTACC 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1113884748 13:113652576-113652598 GGCATCTCTGGCTGCCCTGAAGG 0: 1
1: 0
2: 2
3: 21
4: 243
1113884741_1113884748 -6 Left 1113884741 13:113652559-113652581 CCCCTTTACCTGGCCCTGGCATC 0: 1
1: 0
2: 2
3: 33
4: 413
Right 1113884748 13:113652576-113652598 GGCATCTCTGGCTGCCCTGAAGG 0: 1
1: 0
2: 2
3: 21
4: 243
1113884742_1113884748 -7 Left 1113884742 13:113652560-113652582 CCCTTTACCTGGCCCTGGCATCT 0: 1
1: 0
2: 1
3: 17
4: 231
Right 1113884748 13:113652576-113652598 GGCATCTCTGGCTGCCCTGAAGG 0: 1
1: 0
2: 2
3: 21
4: 243
1113884731_1113884748 25 Left 1113884731 13:113652528-113652550 CCCCTCCCAATCCTGACTCCAGA 0: 1
1: 1
2: 3
3: 52
4: 344
Right 1113884748 13:113652576-113652598 GGCATCTCTGGCTGCCCTGAAGG 0: 1
1: 0
2: 2
3: 21
4: 243
1113884734_1113884748 20 Left 1113884734 13:113652533-113652555 CCCAATCCTGACTCCAGAACTTG 0: 1
1: 0
2: 1
3: 26
4: 224
Right 1113884748 13:113652576-113652598 GGCATCTCTGGCTGCCCTGAAGG 0: 1
1: 0
2: 2
3: 21
4: 243
1113884735_1113884748 19 Left 1113884735 13:113652534-113652556 CCAATCCTGACTCCAGAACTTGA 0: 1
1: 0
2: 3
3: 17
4: 177
Right 1113884748 13:113652576-113652598 GGCATCTCTGGCTGCCCTGAAGG 0: 1
1: 0
2: 2
3: 21
4: 243
1113884732_1113884748 24 Left 1113884732 13:113652529-113652551 CCCTCCCAATCCTGACTCCAGAA 0: 1
1: 0
2: 1
3: 23
4: 276
Right 1113884748 13:113652576-113652598 GGCATCTCTGGCTGCCCTGAAGG 0: 1
1: 0
2: 2
3: 21
4: 243
1113884743_1113884748 -8 Left 1113884743 13:113652561-113652583 CCTTTACCTGGCCCTGGCATCTC 0: 1
1: 0
2: 3
3: 31
4: 266
Right 1113884748 13:113652576-113652598 GGCATCTCTGGCTGCCCTGAAGG 0: 1
1: 0
2: 2
3: 21
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113884748 Original CRISPR GGCATCTCTGGCTGCCCTGA AGG Intronic