ID: 1113885188

View in Genome Browser
Species Human (GRCh38)
Location 13:113655131-113655153
Sequence ACCCAGAGGCAGAACGTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113885188_1113885192 2 Left 1113885188 13:113655131-113655153 CCGGCCACGTTCTGCCTCTGGGT 0: 1
1: 0
2: 2
3: 17
4: 236
Right 1113885192 13:113655156-113655178 GCCCGTCTGGACGTCCACATAGG 0: 1
1: 0
2: 0
3: 1
4: 32
1113885188_1113885196 22 Left 1113885188 13:113655131-113655153 CCGGCCACGTTCTGCCTCTGGGT 0: 1
1: 0
2: 2
3: 17
4: 236
Right 1113885196 13:113655176-113655198 AGGCAGAATCCTGCGACCCGAGG 0: 1
1: 0
2: 1
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113885188 Original CRISPR ACCCAGAGGCAGAACGTGGC CGG (reversed) Intronic
901413372 1:9100553-9100575 ACAAAGAGGCAGAAAGCGGCTGG + Exonic
902116023 1:14121911-14121933 GCCCAGAGGCAGAAGGTGCCTGG + Intergenic
904374768 1:30073493-30073515 ACCCAGAGGCAGCAGGTGCGGGG + Intergenic
904925797 1:34047250-34047272 GCCCTGAGGCAGAACTTGCCAGG - Intronic
905656161 1:39687277-39687299 ACCCATAGGCAAAAGGAGGCAGG + Intronic
908167022 1:61468736-61468758 CCAAAGAGGCAGAACGTGGATGG - Intergenic
913662962 1:121021073-121021095 AGCCAAAAGCAGAACGAGGCCGG - Intergenic
914014344 1:143804338-143804360 AGCCAAAAGCAGAACGAGGCCGG - Intergenic
914163477 1:145156863-145156885 AGCCAAAAGCAGAACGAGGCCGG + Intergenic
914200884 1:145484339-145484361 ACCCAAAGGCACAACCAGGCAGG + Intergenic
914479997 1:148057467-148057489 ACCCAAAGGCACAACCAGGCAGG + Intergenic
914652968 1:149712896-149712918 AGCCAAAAGCAGAACGAGGCCGG - Intergenic
914970644 1:152305733-152305755 ACCAAGAGTCCGCACGTGGCCGG - Exonic
914970799 1:152306705-152306727 ACCAAGAGTCCGCACGTGGCCGG - Exonic
916555965 1:165894682-165894704 AGCAAGTGGCAGAACGGGGCAGG - Intronic
916839349 1:168583997-168584019 ACCCAGAGGAAGAAGGAGGCTGG + Intergenic
919774485 1:201185233-201185255 ACCCTGAGGCAGACTGGGGCAGG - Intergenic
921311923 1:213853135-213853157 AGGCAGAGGCAGAGGGTGGCAGG - Intergenic
921999825 1:221465355-221465377 ATCCGGAGGCAGAACTTTGCAGG - Intergenic
922808122 1:228401160-228401182 AGCCAGCGGCAGAACGTGCTGGG - Exonic
924953978 1:248909861-248909883 ACCTAGAGGCAGAACTGGGTCGG + Intronic
1063672730 10:8112425-8112447 GCCCAGTGGCAGGCCGTGGCTGG - Intergenic
1067766622 10:49091970-49091992 GCCAAGAGGAAGAACGAGGCAGG + Intronic
1069923790 10:71834072-71834094 GCCCAGAGGCAGCATGGGGCAGG + Intronic
1073451629 10:103613104-103613126 ACCCGGAAGAAGAACCTGGCCGG - Exonic
1073538736 10:104300872-104300894 ACCCAGAGCCAGCAGATGGCAGG - Intronic
1076036791 10:127205351-127205373 ACCCAGAGGATGAACCAGGCAGG - Intronic
1076849169 10:133084642-133084664 GCCCTGATGGAGAACGTGGCTGG + Intronic
1077181369 11:1218706-1218728 AACCAGAGACAGGTCGTGGCGGG + Intergenic
1077226322 11:1440467-1440489 ACCCACAGGCTGAGTGTGGCGGG - Intronic
1079240845 11:18721276-18721298 GGGCAGAGCCAGAACGTGGCGGG - Intronic
1083709510 11:64539376-64539398 AACCAGAGGCAGCAGGAGGCTGG + Intergenic
1086152433 11:83626803-83626825 ACCCAGAGGCAGAACCTGAAAGG - Intronic
1089215791 11:116833931-116833953 TCACAGAGCCAGCACGTGGCAGG + Intergenic
1089492529 11:118892805-118892827 GCCCAGAGGCAGAGAGAGGCAGG - Intronic
1090500237 11:127254146-127254168 ACCCAGAAGCCGAAGGTGGAGGG - Intergenic
1091544528 12:1492529-1492551 ACCCAGTGGCTGAGAGTGGCAGG - Exonic
1091686537 12:2566653-2566675 AACCACAGGCAGAAGGTGGAGGG + Intronic
1097344907 12:58480150-58480172 ACTGAGAGGTACAACGTGGCTGG - Intergenic
1100861988 12:98816123-98816145 AGCCAGAGGGAGAACATGTCAGG - Intronic
1102428799 12:112865436-112865458 AACATGAGGAAGAACGTGGCTGG + Exonic
1103955317 12:124573164-124573186 ACCCAGATGAAGAGCGTGCCTGG + Intergenic
1105005578 12:132718724-132718746 AGCCGGAGGCAGAAGGTGGTTGG - Intronic
1106754995 13:32813710-32813732 GCCCAGAGGCAGAACAAGTCTGG - Intergenic
1107832898 13:44390260-44390282 ACCAAGAGGCAGCCTGTGGCTGG - Intronic
1112907842 13:104446233-104446255 GCCCAGAGGCAGTGGGTGGCTGG - Intergenic
1113885188 13:113655131-113655153 ACCCAGAGGCAGAACGTGGCCGG - Intronic
1114242333 14:20880082-20880104 ACCCTGTGCCAGAACGGGGCTGG + Intergenic
1115289433 14:31753257-31753279 TGCCAGTGGCAGAAGGTGGCAGG + Intronic
1117211742 14:53507781-53507803 AGCCAGAGGCAGAGCCTTGCAGG + Intergenic
1118736684 14:68706048-68706070 ACCCAGAGCCAGGCCCTGGCTGG + Intronic
1119429042 14:74553805-74553827 AGCCAGAGGCAGAAGGTTGAGGG + Intronic
1120032251 14:79655283-79655305 TCACAGAGCCAGAAAGTGGCAGG - Intronic
1122016021 14:98797300-98797322 AGCCTGAGGCTGAACCTGGCAGG + Intergenic
1123118053 14:105903582-105903604 ACCCAGTGGCAAAAACTGGCTGG - Intergenic
1125764245 15:42122713-42122735 AGCCAAAGACAGAACGTGGTGGG + Intergenic
1125944858 15:43704587-43704609 ACCCAGAGGCAAAACGGGCCAGG + Intergenic
1127327798 15:57912332-57912354 AACCAGAGGCAGCACCTGCCAGG - Intergenic
1129458380 15:75687759-75687781 ACTCAGGGGCTGACCGTGGCTGG - Exonic
1130041225 15:80406307-80406329 ACACTGAGGAGGAACGTGGCTGG + Intronic
1130274061 15:82467421-82467443 ACCCAAAGGCAGAACATGAAGGG + Intergenic
1130466409 15:84194795-84194817 ACCCAAAGGCAGAACATGAAGGG + Intergenic
1130497855 15:84478741-84478763 ACCCAAAGGCAGAACATGAAGGG - Intergenic
1130588703 15:85199388-85199410 ACCCAAAGGCAGAACATGAAGGG + Intergenic
1132542298 16:516192-516214 ACCCAGGGGCAGCACAGGGCTGG - Intronic
1135551230 16:23399702-23399724 ACACAGAGGCAGACAGAGGCTGG + Intronic
1136716299 16:32286437-32286459 ACCCACAGGCAGACCCTGGGAGG - Intergenic
1136746968 16:32598978-32599000 TTCCAGAGGCAGAAGCTGGCAGG - Intergenic
1136834685 16:33492715-33492737 ACCCACAGGCAGACCCTGGGAGG - Intergenic
1137953506 16:52806190-52806212 ACACAGAAGAAGAACTTGGCCGG + Intergenic
1141360134 16:83388087-83388109 ACCCTGAGGCTGTACTTGGCTGG + Intronic
1141856395 16:86683982-86684004 ACACAGAGAGAGAACGAGGCAGG - Intergenic
1142123554 16:88399122-88399144 ACCCAGGGGCTGCATGTGGCTGG + Intergenic
1203010118 16_KI270728v1_random:231317-231339 ACCCACAGGCAGACCCTGGGAGG + Intergenic
1203049098 16_KI270728v1_random:858182-858204 TTCCAGAGGCAGAAGCTGGCAGG - Intergenic
1203144854 16_KI270728v1_random:1793003-1793025 ACCCACAGGCAGACCCTGGGAGG - Intergenic
1143319091 17:6056398-6056420 ACCCAGTGGCAGAACAAAGCTGG - Intronic
1144075878 17:11719103-11719125 ACCCAGAAGAAGAACCTGTCAGG + Intronic
1147208752 17:38858383-38858405 AAACAAAGGCAGAACGTGGAAGG - Intergenic
1148043795 17:44729621-44729643 ACCCAGTGGCAGAAGGCTGCGGG - Intronic
1148549262 17:48541106-48541128 ACCCAGAGGCAGCAATTGTCAGG - Intronic
1149143579 17:53462787-53462809 ACCCAAAGGCAGAACCTGAAAGG + Intergenic
1151752256 17:76046275-76046297 ACCCAGAGGAAGCAGGGGGCGGG + Intronic
1152066219 17:78113905-78113927 AGGCAGAGCCAGTACGTGGCAGG - Intronic
1152463603 17:80454020-80454042 GCCCTGAGGCAGGACGGGGCAGG + Intergenic
1153319691 18:3760333-3760355 ACCCAGGAGCAGAACTCGGCAGG - Intronic
1153563815 18:6398966-6398988 ACCCACCAGCAGAAAGTGGCTGG - Intronic
1154123308 18:11669287-11669309 ATACAGAGCCAGAGCGTGGCAGG + Intergenic
1157301090 18:46479935-46479957 ACCCAGAGCCAGAGCCTGCCTGG + Intronic
1157591714 18:48840196-48840218 ACCCAGAGGCAGATAAGGGCAGG + Intronic
1158667865 18:59449159-59449181 TCCCACAGGTAGAAAGTGGCAGG - Intronic
1158933604 18:62344848-62344870 ACCCAGAGGATGAACCTGACAGG + Intronic
1160375693 18:78410089-78410111 GCCCAAAGGGAGAACCTGGCAGG + Intergenic
1160444272 18:78914976-78914998 AACAAGAGGCAGGACTTGGCAGG + Intergenic
1160543355 18:79637765-79637787 ACCCAGAGGCAGCCCCTGGCCGG - Intergenic
1160584504 18:79904898-79904920 AGCCAGAGGCAGAGCCTGGGTGG + Intronic
1160810270 19:1010254-1010276 TCCCAGAGGAAGGAGGTGGCTGG + Exonic
1161089492 19:2352884-2352906 ACCCAGAGGAGGACCCTGGCAGG - Intronic
1161494346 19:4579424-4579446 AACCAGAGGCAAAATGGGGCAGG + Intergenic
1161760592 19:6168229-6168251 ACCAAGAGGCAGGACGTGTCTGG - Intronic
1163142577 19:15360271-15360293 ACCCAGGGCCAGAAAGTGACAGG + Intronic
1164937309 19:32224437-32224459 TCGCAGAAGCAGAACTTGGCAGG - Intergenic
1165012585 19:32859622-32859644 AAGCAGAGGCAGAAAGTGCCAGG - Intronic
1165098535 19:33424234-33424256 CACCAGAGGCAGAACTTGACTGG + Intronic
1165894565 19:39133834-39133856 TCCCAGAGGCGGAAGGCGGCCGG + Intronic
1166079322 19:40433983-40434005 CCCCAGAGGCCGGACGGGGCGGG - Intergenic
1167006012 19:46777107-46777129 ACCCTGAGGGAGAAGGTGGGAGG + Exonic
1167502667 19:49856571-49856593 GCCCAGAAGCAGGAGGTGGCTGG + Intronic
1167707286 19:51089066-51089088 ACCCAGATAAAGAACTTGGCTGG - Intergenic
1168469722 19:56630328-56630350 ACTCAGAGGCAGGACAAGGCGGG + Intergenic
925063962 2:914868-914890 ACCCACAGGCAGAAGATGGAAGG + Intergenic
925064000 2:915040-915062 ACCCACAGGCAGAAGATGGAAGG + Intergenic
925064020 2:915126-915148 ACCCACAGGCAGAAGATGGAAGG + Intergenic
926086458 2:10023263-10023285 GCCCAGAGTCAGAAAGTGCCCGG + Intergenic
926218644 2:10920895-10920917 TCCCAGGGCCAGAACGCGGCTGG - Intergenic
927282401 2:21320792-21320814 GCCCAGAGGCAGCATGTGGTTGG + Intergenic
927786964 2:25981148-25981170 AGCGAGAGGCAGAACAAGGCAGG - Exonic
929847436 2:45544449-45544471 AATCAGAGGCAGTAGGTGGCAGG + Intronic
935570957 2:104659640-104659662 CCCCAGAGTCAGAAGGTCGCGGG + Intergenic
937114319 2:119393648-119393670 AGGCAGAGGCAGAACCTGGAAGG - Intergenic
937674753 2:124578011-124578033 ACCAAGATGCTGAACATGGCCGG + Intronic
942071979 2:172324468-172324490 ACCCAGGGGCTGACCGTGGCCGG + Intergenic
1172520293 20:35561531-35561553 GCCCAGAGGCAGAAAGTGACAGG + Intergenic
1174005923 20:47410641-47410663 ACCCAGGGGCTCAACATGGCTGG - Intergenic
1174409181 20:50322450-50322472 CCACAGAGGCAGAACATGGTAGG + Intergenic
1174828009 20:53786462-53786484 ACCCAGAGGCAGATTATGGGAGG - Intergenic
1175996928 20:62816242-62816264 AGCCTGAGGCAGAGCTTGGCCGG + Intronic
1176042348 20:63072277-63072299 ACCCAGAGGCGCAGCGGGGCCGG + Intergenic
1176172141 20:63700871-63700893 AGCCCGAGGCTGAACATGGCTGG + Intronic
1177048512 21:16201865-16201887 ACCCTCAGGCAGAGAGTGGCAGG + Intergenic
1179455020 21:41493304-41493326 ACTCAGAGACAGGAGGTGGCTGG + Intronic
1180670396 22:17548530-17548552 CCCCAGAGGCAGAACGTTGCAGG + Exonic
1181172655 22:21018387-21018409 ACCCAGAGGCAGGACCAGGATGG - Intronic
1181437502 22:22919166-22919188 ACCCAGAGGAGGGACCTGGCAGG + Intergenic
1183675657 22:39297554-39297576 TCCCAGTGGCAGAACGTGCTGGG - Intergenic
1183758139 22:39790010-39790032 ACCCACAGGCAGGAGGGGGCTGG + Intronic
1184014874 22:41778361-41778383 TCCCACAGCCAGAAAGTGGCAGG - Intronic
1184490024 22:44803153-44803175 ACTCTGAGACAGAAGGTGGCAGG + Intronic
1184892670 22:47389410-47389432 AGGCAGGAGCAGAACGTGGCTGG - Intergenic
1185006029 22:48277451-48277473 ACCCAGAGGCAGAAGAAGGTGGG + Intergenic
1185011587 22:48317610-48317632 GCCCAGGGGTAGAAGGTGGCAGG + Intergenic
1185052213 22:48559790-48559812 ACCCAGAGGCGGAGCGCGGCGGG + Intronic
949096285 3:89733-89755 ACACAGAGGCAGAAGGGAGCCGG + Intergenic
950668631 3:14512145-14512167 GCCCAGAGGCAGGAAGGGGCAGG + Intronic
950859251 3:16133014-16133036 TCCAAGAGGCAGAAGCTGGCTGG - Intergenic
952622671 3:35364610-35364632 ACCCTTAGGCAGAAAGAGGCGGG - Intergenic
953820390 3:46203148-46203170 GCCAAGAGTCAGAACCTGGCTGG + Exonic
954287760 3:49630862-49630884 AGCCAGAGGCAGGAAGAGGCAGG + Intronic
956264508 3:67381848-67381870 ACCCAGTGGCAGAAAGTCACTGG - Intronic
961516426 3:127440237-127440259 ACTCAGAGGCTGAAGGGGGCTGG + Intergenic
962151734 3:132900897-132900919 ACCCAAAGGCAAAATGTAGCTGG - Intergenic
962407448 3:135112075-135112097 ACCAGGAAGCACAACGTGGCTGG + Intronic
963700315 3:148618020-148618042 ACCAAGCAGCAGAACGTGGGTGG + Intergenic
966598869 3:181754802-181754824 ACCTACAGACAGCACGTGGCTGG + Intergenic
967904325 3:194487744-194487766 AGCCAGAGGCTGCAGGTGGCCGG - Intronic
968462669 4:733097-733119 AGCCTGAGGCAGCACGGGGCAGG - Intronic
969437625 4:7197842-7197864 TCCCAGAGCCAGAGAGTGGCAGG - Intronic
969578290 4:8049006-8049028 ACCCAGAGCCAGAACCAGACTGG + Intronic
969917151 4:10502041-10502063 AGCCAGAGGCAGAAAGCTGCAGG - Intronic
975061589 4:70009552-70009574 ACCCAGAGTCAGAAAGTGAGAGG + Intergenic
978367209 4:107994984-107995006 AGCTGGAGGCAGAACATGGCAGG - Intronic
982130687 4:152226219-152226241 ATCCAGAGGCAGAACATTCCCGG + Intergenic
982209122 4:153020727-153020749 ACACACAGGGAGAACATGGCGGG + Intergenic
983296971 4:165878669-165878691 ACCCAGAAGCAAAACGTGGGAGG - Intronic
983961424 4:173759854-173759876 ACCCAGAGGCAGTACATACCAGG - Intergenic
984694343 4:182764621-182764643 ACCCAGGAGCAGAACGTGGCAGG + Intronic
984899635 4:184573643-184573665 ACCCAGAGGCAGAAATTGCAGGG + Intergenic
985835980 5:2272246-2272268 ACCCTGTGCCAGAAGGTGGCTGG + Intergenic
986038512 5:3963506-3963528 ACCTGGAGGAAGAACATGGCAGG - Intergenic
986349021 5:6859715-6859737 ACACAGAGGCAGAAATTGGAGGG - Intergenic
986824644 5:11507436-11507458 ACCCAGAGGCAGAAAGGAACTGG + Intronic
988314728 5:29610117-29610139 ACCCAGAGCCAGAGGGTGGAAGG - Intergenic
991374923 5:65956789-65956811 ACCCTGAAGCACAACGTAGCTGG + Intronic
991437422 5:66610801-66610823 CCCCAGAGCCACAACGTGGCTGG - Intronic
993109243 5:83635273-83635295 ACCCGGAGACAGTAGGTGGCAGG + Intergenic
993744556 5:91580883-91580905 ACCCAGAGGGAGAAAATGGCAGG + Intergenic
997302266 5:132814300-132814322 GCCCGGAGGCGGAGCGTGGCGGG - Exonic
997428040 5:133817687-133817709 TCCCATGGGCAGAACTTGGCAGG + Intergenic
998352879 5:141512567-141512589 ACCCAGGGGCAGAAGGGGGTGGG - Exonic
1001986439 5:176077362-176077384 TTCCAGAGGCAGAAGCTGGCAGG - Intronic
1002230428 5:177760763-177760785 TTCCAGAGGCAGAAGCTGGCAGG + Intronic
1002264908 5:178022984-178023006 TTCCAGAGGCAGAAGCTGGCAGG - Intronic
1002554102 5:180020780-180020802 ACACAGAGGCAGAAGGGGGGTGG + Intronic
1002691282 5:181052656-181052678 GCCCGCAGGCAGGACGTGGCCGG - Intronic
1002942506 6:1730532-1730554 TCCCTGAGGTAGAAGGTGGCTGG + Intronic
1006056777 6:31391060-31391082 ACCCACAGGCCAAAAGTGGCTGG + Intergenic
1006583866 6:35092720-35092742 ACACAGAGGCAGAATGTGTAAGG - Intergenic
1007344243 6:41216425-41216447 ACCCTGGGGCAGATGGTGGCTGG - Intergenic
1007707010 6:43797330-43797352 ACCGTGAGGCAGAACCAGGCCGG - Intergenic
1008492626 6:52102188-52102210 AAACAGAGGCAGAAAATGGCAGG + Intergenic
1010389045 6:75315723-75315745 TCCCAGAGTCAGTAAGTGGCAGG + Intronic
1013092018 6:106908623-106908645 AGCCAGAGCCAGAGCGTGGTGGG + Intergenic
1016044365 6:139466142-139466164 TCCCAGAGGCAAACAGTGGCAGG - Intergenic
1016646301 6:146412345-146412367 ACCGAGAGCCAGATCCTGGCTGG + Intronic
1017766294 6:157609861-157609883 ACCCAGAGGCAGATCCAGCCTGG + Intronic
1018399263 6:163405807-163405829 ACACAGAGGCAGGGCCTGGCTGG + Intergenic
1018891835 6:167988310-167988332 AGCCAGAGGCAGGAGGAGGCAGG + Intergenic
1018998650 6:168729198-168729220 CACCAGAGGCTGAGCGTGGCAGG - Intergenic
1019030670 6:169008140-169008162 AAGCAGAGGCAGAACGAAGCAGG + Intergenic
1020031297 7:4934671-4934693 ACCCAGAGCCAGATGCTGGCAGG + Intronic
1020042996 7:5018216-5018238 ACCCCGAGGCAAAATGTGTCAGG - Intronic
1021457363 7:20844247-20844269 ACTAAGAGGCAGAATGTGGTTGG + Intergenic
1021675636 7:23077802-23077824 ACACAGAGGTAGAAAGTGGCAGG - Intergenic
1023024006 7:36035120-36035142 AGGCAGAGGCAGAACTTGGCGGG - Intergenic
1024608766 7:51045471-51045493 TCCCATAGGCAGAGTGTGGCAGG + Intronic
1024981529 7:55161320-55161342 TCCCAGAGGCCGACCGTGACTGG - Intronic
1026760449 7:73122273-73122295 ACCCAGAGGAACCAAGTGGCTGG + Intergenic
1027036791 7:74931094-74931116 ACCCAGAGGAACCAAGTGGCTGG + Intergenic
1027086772 7:75270365-75270387 ACCCAGAGGAACCAAGTGGCTGG - Intergenic
1027939775 7:84661752-84661774 ATCAAGAGGCAGAAAATGGCAGG + Intergenic
1029393074 7:100288355-100288377 ACCCAGAGGAACCAAGTGGCTGG - Intergenic
1029606135 7:101600585-101600607 ACACATAGGCAGGAAGTGGCAGG - Intergenic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1030675815 7:112384377-112384399 ACCCAGAGGAAGAGCGTTCCAGG - Intergenic
1031986887 7:128168996-128169018 ACCCAGGGCCAGAACCTGCCTGG + Intergenic
1032550272 7:132778312-132778334 AACCAGAGCCAGAACAAGGCAGG - Intergenic
1034565907 7:151915617-151915639 AACAATAGGCAGAACCTGGCTGG - Intergenic
1034701506 7:153100014-153100036 ACCCAGAGACAGAAGCTGGGAGG - Intergenic
1035622557 8:1044832-1044854 ACCCTGAGGAAGCACGTGGGTGG - Intergenic
1035742927 8:1942885-1942907 ATCCAGAGACAGAACGTGGATGG + Intronic
1036441278 8:8782976-8782998 ACCCTGAGGCAGTATGTAGCAGG + Intergenic
1038857124 8:31346066-31346088 ACCCACATGGAGAACCTGGCAGG + Intergenic
1039097453 8:33901947-33901969 ACCCAGAGGAAGCACTTGTCAGG + Intergenic
1040009706 8:42651181-42651203 AGCCAGAGACAGAACTGGGCTGG - Intergenic
1040671885 8:49701944-49701966 ACCCAGGCACAGAAAGTGGCAGG + Intergenic
1041494731 8:58472902-58472924 ACAGAGAGGCAGCACGTGGCAGG + Intergenic
1042415514 8:68513735-68513757 ACGCAGTGGCAGCACATGGCTGG + Intronic
1044836814 8:96303558-96303580 GCCCAGAGACAGCAAGTGGCTGG - Intronic
1047027010 8:120835254-120835276 ATGGAGAGGCAGAACGTGACAGG - Intergenic
1047509489 8:125505635-125505657 GCCCTGGGGCAGAACCTGGCAGG - Intergenic
1048410228 8:134164710-134164732 ACCCAGAAGAAGACCATGGCTGG - Intergenic
1049010203 8:139882326-139882348 TCCCTGACGCAGCACGTGGCTGG + Intronic
1049450610 8:142659525-142659547 ACCCAGGGGCAGATTGTGGGAGG - Intronic
1049562212 8:143317489-143317511 CCCCGCAGGGAGAACGTGGCTGG + Intronic
1050266505 9:3896255-3896277 ACCAAGAGGCAGAACCAGGCAGG - Intronic
1051736964 9:20210216-20210238 ACCCAGACCCAGCACCTGGCAGG + Intergenic
1056406633 9:86282011-86282033 AAGCAGAGGCTGAACGTGCCCGG - Intronic
1056471450 9:86908415-86908437 ACCCACAGGCACAAGGAGGCGGG + Intergenic
1056525200 9:87436813-87436835 ACCCACAGGCAGCCCATGGCTGG - Intergenic
1056795813 9:89658219-89658241 GCCAAGAGGCTGAACTTGGCAGG + Intergenic
1058492814 9:105520060-105520082 TCCCAGCGGCAGAAAGTGGAGGG - Intronic
1060471865 9:123954784-123954806 GCCCAGAGGCAGCACCTGCCTGG + Intergenic
1061207110 9:129171184-129171206 AGACAGAAGCAGAACCTGGCTGG - Intergenic
1061546993 9:131310106-131310128 AAACAGAGGCAGAGAGTGGCGGG - Intergenic
1061868034 9:133505454-133505476 ATCCAGTGGCAGAACAGGGCAGG + Intergenic
1203444626 Un_GL000219v1:44180-44202 AGTCAGAGGCAGAACGGTGCTGG - Intergenic
1186407795 X:9318823-9318845 GCCCAGAGGCAGAAAGCAGCCGG - Intergenic
1186424922 X:9456409-9456431 ACACAAAGGCAGAGCATGGCTGG - Intergenic
1186812754 X:13206478-13206500 ACCCAAAGACAGAACGTAGGAGG + Intergenic
1186821352 X:13291188-13291210 ACGCAGGCGCAGAAAGTGGCGGG - Intergenic
1186821366 X:13291249-13291271 ACGCAGGCGCAGAAAGTGGCGGG - Intergenic
1190326859 X:49211857-49211879 ACCCACGGGCATAAGGTGGCAGG + Intronic
1190456688 X:50634479-50634501 AGCCAGAGGCAGAGGGTTGCTGG + Exonic
1191685534 X:63885538-63885560 CCCCAGTGGCAGCACATGGCAGG - Intergenic
1191754535 X:64580197-64580219 AGCTAGAGGCAGCAGGTGGCTGG + Intergenic
1195389150 X:104342933-104342955 AGCCAGAGGCTGAAGCTGGCAGG + Intergenic