ID: 1113885544

View in Genome Browser
Species Human (GRCh38)
Location 13:113656810-113656832
Sequence GACTCCCATGTGCCGCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 102}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113885544_1113885548 7 Left 1113885544 13:113656810-113656832 CCAGGAGGCGGCACATGGGAGTC 0: 1
1: 0
2: 0
3: 4
4: 102
Right 1113885548 13:113656840-113656862 CTAGAATGGCCCAAAAGATGGGG 0: 1
1: 0
2: 1
3: 9
4: 121
1113885544_1113885545 -7 Left 1113885544 13:113656810-113656832 CCAGGAGGCGGCACATGGGAGTC 0: 1
1: 0
2: 0
3: 4
4: 102
Right 1113885545 13:113656826-113656848 GGGAGTCTCAGCATCTAGAATGG 0: 1
1: 0
2: 0
3: 20
4: 159
1113885544_1113885553 26 Left 1113885544 13:113656810-113656832 CCAGGAGGCGGCACATGGGAGTC 0: 1
1: 0
2: 0
3: 4
4: 102
Right 1113885553 13:113656859-113656881 GGGGCTTCCAAGGACCTGGCCGG 0: 1
1: 0
2: 5
3: 25
4: 283
1113885544_1113885552 22 Left 1113885544 13:113656810-113656832 CCAGGAGGCGGCACATGGGAGTC 0: 1
1: 0
2: 0
3: 4
4: 102
Right 1113885552 13:113656855-113656877 AGATGGGGCTTCCAAGGACCTGG 0: 1
1: 1
2: 3
3: 16
4: 248
1113885544_1113885550 16 Left 1113885544 13:113656810-113656832 CCAGGAGGCGGCACATGGGAGTC 0: 1
1: 0
2: 0
3: 4
4: 102
Right 1113885550 13:113656849-113656871 CCCAAAAGATGGGGCTTCCAAGG 0: 1
1: 0
2: 0
3: 15
4: 179
1113885544_1113885546 5 Left 1113885544 13:113656810-113656832 CCAGGAGGCGGCACATGGGAGTC 0: 1
1: 0
2: 0
3: 4
4: 102
Right 1113885546 13:113656838-113656860 ATCTAGAATGGCCCAAAAGATGG 0: 1
1: 0
2: 0
3: 5
4: 134
1113885544_1113885547 6 Left 1113885544 13:113656810-113656832 CCAGGAGGCGGCACATGGGAGTC 0: 1
1: 0
2: 0
3: 4
4: 102
Right 1113885547 13:113656839-113656861 TCTAGAATGGCCCAAAAGATGGG 0: 1
1: 0
2: 0
3: 5
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113885544 Original CRISPR GACTCCCATGTGCCGCCTCC TGG (reversed) Intronic
901841751 1:11958088-11958110 GCCACCCAAGTGCCTCCTCCTGG + Intronic
902377256 1:16035621-16035643 GAGTCCCAGGTTCCTCCTCCAGG + Intergenic
903381563 1:22900595-22900617 GGCTCCCATGCTCCGTCTCCTGG + Intronic
905094948 1:35462179-35462201 GATTCTCATCAGCCGCCTCCTGG - Intronic
914796416 1:150924000-150924022 GCCTCCCGGGTTCCGCCTCCTGG - Intergenic
915977437 1:160400481-160400503 AGCTCCCGGGTGCCGCCTCCCGG - Intergenic
919889431 1:201959923-201959945 CACTGCCAAGTTCCGCCTCCCGG - Intronic
1064228003 10:13504363-13504385 GACTACCATGTGCCCCTCCCCGG - Intronic
1068686967 10:59880515-59880537 GACTCCACTGTGCCCCCTTCCGG - Intronic
1076706736 10:132306487-132306509 GAATCCCCGGTGCCGTCTCCCGG + Intronic
1076713972 10:132354018-132354040 GACTCCCACAGGCAGCCTCCTGG - Intronic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1082644250 11:55702059-55702081 GACTCCCATACCCTGCCTCCAGG + Intergenic
1083686636 11:64380473-64380495 GGCTCCCCTCTGCAGCCTCCAGG - Intergenic
1091463466 12:663599-663621 GTGTGCCATGTGCCACCTCCTGG - Exonic
1091804824 12:3348267-3348289 GAGGCCCAGGTGCTGCCTCCTGG - Intergenic
1095097690 12:38157025-38157047 GCATCCCATGTGCCATCTCCGGG + Intergenic
1099152102 12:79126989-79127011 GACTCCCAAGTGTCTCTTCCTGG - Intronic
1100272402 12:93038922-93038944 GACTCCCTTCTGGTGCCTCCCGG - Intergenic
1101144507 12:101828582-101828604 GATTCTCATGTCTCGCCTCCTGG - Intronic
1103936136 12:124477939-124477961 GGCTCCCCTGTGCCAGCTCCAGG + Intronic
1104742731 12:131190204-131190226 CACTCCCAAGTGCAGCCTGCTGG + Intergenic
1113885544 13:113656810-113656832 GACTCCCATGTGCCGCCTCCTGG - Intronic
1122347639 14:101070438-101070460 GCCTCCCGTGTGCTTCCTCCTGG - Intergenic
1122362679 14:101176618-101176640 GGCTCCCCTGTGTCTCCTCCAGG - Intergenic
1123193411 14:106592891-106592913 GACTCTCCTGTGCAGCCTCTGGG - Intergenic
1123202043 14:106675230-106675252 GACTCTCCTGTGCAGCCTCTGGG - Intergenic
1127691543 15:61402162-61402184 CACTGCCATGTGCCCCATCCTGG + Intergenic
1129113195 15:73350263-73350285 AACTCCCATGCCCCTCCTCCTGG + Intronic
1129198005 15:73982517-73982539 CACTGCCTTGTCCCGCCTCCTGG - Exonic
1129227879 15:74180368-74180390 CACTTCCATGTGCTGCCTGCAGG - Intronic
1129232827 15:74206200-74206222 GCCTCCCACCTGCCCCCTCCTGG + Intronic
1129739880 15:77985080-77985102 GCCACCCATGTGCCCCCGCCAGG + Intronic
1132315349 15:100886341-100886363 GACTCCCAAGTGCCCCGTACAGG + Intronic
1132480902 16:165694-165716 TCCTCCCATGTGCTCCCTCCTGG + Intronic
1132590198 16:723252-723274 CACTCCCAGGTGTCCCCTCCCGG - Intronic
1132593382 16:736605-736627 GCCTCCCAGGTTCAGCCTCCTGG + Intronic
1133130040 16:3671378-3671400 GACTCCAGTGTGCTGGCTCCAGG - Intronic
1136285183 16:29236531-29236553 GACTCCTGGGTGCCGTCTCCGGG - Intergenic
1136298388 16:29316870-29316892 ACCTCACATGTGCAGCCTCCAGG - Intergenic
1138270143 16:55690236-55690258 GACTCACATGTGCCGGATTCTGG + Intronic
1142045905 16:87925131-87925153 GCATCCCATCTGCCTCCTCCCGG - Intronic
1142090246 16:88206155-88206177 GACTCCTGGGTGCCGTCTCCGGG - Intergenic
1143965606 17:10754704-10754726 GCCTCCCATGTGCTGGCTCTGGG - Intergenic
1147184401 17:38705611-38705633 TACTCCCATGAGCTCCCTCCGGG - Exonic
1148442955 17:47721207-47721229 GCCTACCGAGTGCCGCCTCCCGG + Intergenic
1149445488 17:56710261-56710283 GAACCCCACGTCCCGCCTCCTGG + Intergenic
1160870418 19:1275321-1275343 GACTCCCACGGGCGGGCTCCGGG + Intergenic
1160915617 19:1495170-1495192 TCCTCCCAGGAGCCGCCTCCAGG - Intronic
1161078625 19:2299317-2299339 GTCTCCCATGTCCCCTCTCCAGG - Intronic
1161682540 19:5687260-5687282 GACTCGCGAGTGCCGCCTGCAGG + Exonic
1162580851 19:11529317-11529339 GACTCCCAAGTCCAGCCTCCCGG - Intergenic
1163108470 19:15141858-15141880 CACTCCCATGTACCACTTCCTGG - Intergenic
1166860227 19:45805926-45805948 GTCTCCCATGTGTTGCCTCATGG - Intronic
1168056014 19:53865871-53865893 GACTCCCCTGGGACGCCTCTAGG - Intergenic
926035723 2:9633958-9633980 TCCTCCCATGTTCAGCCTCCCGG - Intergenic
926240804 2:11083572-11083594 CATTCCCATGTGTCTCCTCCAGG + Intergenic
927644165 2:24865368-24865390 GACTCACAACTTCCGCCTCCTGG - Intronic
931121852 2:59228569-59228591 GACTTCCATGGGCCAACTCCAGG + Intergenic
932344213 2:70985155-70985177 GTCACCCAGGTGCCGCTTCCTGG - Exonic
932397043 2:71455502-71455524 GACTCCCATGTCCTCCCTGCTGG - Intronic
935783060 2:106524808-106524830 GATTCCCATGTGCAGCCTGGTGG - Intergenic
944842149 2:203634737-203634759 GACCCCCCAGTGCCGCCTCATGG - Intergenic
948055335 2:235006185-235006207 GACTCCCATCTCCCACCTGCTGG - Intronic
948463737 2:238142503-238142525 GACACCCTCGTGCCGCCTGCTGG + Intronic
1172152352 20:32799278-32799300 GACTCGAATGGGCCGCCTTCGGG - Exonic
1175987320 20:62770531-62770553 TCCTCCCATCTGCCCCCTCCAGG - Intergenic
1181053071 22:20246744-20246766 GCCTGCCCTGTGCTGCCTCCTGG - Intronic
1181979101 22:26753336-26753358 TTCTCCCATCTGCCCCCTCCTGG - Intergenic
1183554222 22:38512684-38512706 GCCTCTCAAGTGCCGCCTTCAGG - Intergenic
1183946727 22:41330500-41330522 GTTTCCCTTGTGCAGCCTCCTGG - Intronic
1184777880 22:46632329-46632351 GTCTCCCATCTCCTGCCTCCTGG - Intronic
1184944813 22:47795679-47795701 GACTCACAGGTGACCCCTCCTGG + Intergenic
1185157596 22:49203564-49203586 GACTCCAAAGGGGCGCCTCCTGG + Intergenic
950006664 3:9695875-9695897 GCCTGCCCTGTGCCCCCTCCAGG - Intronic
950463951 3:13142292-13142314 GACTCTCCTGTGCAGCCTGCAGG - Intergenic
950759974 3:15213953-15213975 CACTGCCAAGTTCCGCCTCCGGG + Intronic
951941291 3:28081647-28081669 GACTCCCATGTGCAGCTGTCTGG - Intergenic
952702597 3:36342382-36342404 GATTCCCATTTGCCACCTCCTGG + Intergenic
953865073 3:46576895-46576917 GACTCTGATGTGCCGCTTGCAGG - Intronic
960861090 3:122154310-122154332 CACCCCCATGTGCCACCTGCAGG + Intergenic
962198488 3:133382467-133382489 GTCTCCCATCTGCCCCCTCTGGG + Intronic
968892793 4:3380211-3380233 GACTCCCATGTCCCACATCCAGG + Intronic
968913293 4:3486421-3486443 AGCTCACATGTGGCGCCTCCTGG + Intronic
981183078 4:141768466-141768488 CACTCTCATGCTCCGCCTCCCGG - Intergenic
983398450 4:167233713-167233735 CTCTCCCCTGTGCCCCCTCCCGG - Intronic
986340598 5:6786008-6786030 AACTCCCATGAGGCGTCTCCAGG - Intergenic
992401076 5:76411961-76411983 GCCCCCCATGTGCCACCCCCAGG - Intronic
997893877 5:137698518-137698540 GAATCCCTTCTGCTGCCTCCTGG - Intronic
999123378 5:149227594-149227616 GATTCCCAGGTCCCACCTCCAGG + Intronic
1001744694 5:174083225-174083247 GACTCCCATGTGCCTGGCCCAGG + Intronic
1006941643 6:37755654-37755676 GACTCCTCTGTGCCGCCAACTGG - Intergenic
1011495120 6:87929981-87930003 GGTTCCCATGTGCCACCTGCTGG - Intergenic
1025088040 7:56039066-56039088 GCCTCCCGGGTTCCGCCTCCCGG - Intronic
1026845478 7:73696790-73696812 GCCTCTCATGTGCCTCCTGCAGG + Intronic
1030266748 7:107629377-107629399 AGCTGCCATGTGCAGCCTCCTGG + Intergenic
1035520947 8:274623-274645 GGTTCCCATCTGCCGCCTCCAGG + Intergenic
1035534545 8:381185-381207 TGCTCCCATCTGCAGCCTCCAGG - Intergenic
1036486348 8:9182877-9182899 GAATCCCATTTGTCACCTCCTGG - Intergenic
1036643926 8:10600709-10600731 GCCTCCCCGGTGCTGCCTCCAGG + Intergenic
1041521673 8:58763711-58763733 GGCTCCTTTGTGCCCCCTCCTGG - Intergenic
1048901200 8:139039609-139039631 GACCCCCATCTCCCACCTCCAGG + Intergenic
1049322003 8:142001591-142001613 TTCTCCCTTGTGCTGCCTCCTGG + Intergenic
1056553927 9:87673723-87673745 GACTCCCATGTGATGTCACCAGG - Intronic
1062669061 9:137695660-137695682 GGCACCCATGTGTGGCCTCCCGG + Intronic
1187068242 X:15862390-15862412 GACTCCTATGTTCTGTCTCCAGG + Intergenic
1196933508 X:120705536-120705558 GACTCCCATGTTCCTGCTGCTGG - Intergenic