ID: 1113885965

View in Genome Browser
Species Human (GRCh38)
Location 13:113658532-113658554
Sequence CCCAAGGTCGTGGACACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 129}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113885965_1113885970 -9 Left 1113885965 13:113658532-113658554 CCCACTGTGTCCACGACCTTGGG 0: 1
1: 0
2: 2
3: 6
4: 129
Right 1113885970 13:113658546-113658568 GACCTTGGGCTGAGCCAGCTGGG 0: 1
1: 0
2: 1
3: 17
4: 211
1113885965_1113885969 -10 Left 1113885965 13:113658532-113658554 CCCACTGTGTCCACGACCTTGGG 0: 1
1: 0
2: 2
3: 6
4: 129
Right 1113885969 13:113658545-113658567 CGACCTTGGGCTGAGCCAGCTGG 0: 1
1: 0
2: 1
3: 11
4: 124
1113885965_1113885975 9 Left 1113885965 13:113658532-113658554 CCCACTGTGTCCACGACCTTGGG 0: 1
1: 0
2: 2
3: 6
4: 129
Right 1113885975 13:113658564-113658586 CTGGGGCCGCATCCCTGGCCTGG 0: 1
1: 0
2: 3
3: 32
4: 342
1113885965_1113885976 10 Left 1113885965 13:113658532-113658554 CCCACTGTGTCCACGACCTTGGG 0: 1
1: 0
2: 2
3: 6
4: 129
Right 1113885976 13:113658565-113658587 TGGGGCCGCATCCCTGGCCTGGG 0: 1
1: 0
2: 0
3: 19
4: 253
1113885965_1113885971 -8 Left 1113885965 13:113658532-113658554 CCCACTGTGTCCACGACCTTGGG 0: 1
1: 0
2: 2
3: 6
4: 129
Right 1113885971 13:113658547-113658569 ACCTTGGGCTGAGCCAGCTGGGG 0: 1
1: 0
2: 1
3: 25
4: 271
1113885965_1113885981 21 Left 1113885965 13:113658532-113658554 CCCACTGTGTCCACGACCTTGGG 0: 1
1: 0
2: 2
3: 6
4: 129
Right 1113885981 13:113658576-113658598 CCCTGGCCTGGGAGGGCGTGAGG 0: 1
1: 0
2: 2
3: 63
4: 572
1113885965_1113885978 14 Left 1113885965 13:113658532-113658554 CCCACTGTGTCCACGACCTTGGG 0: 1
1: 0
2: 2
3: 6
4: 129
Right 1113885978 13:113658569-113658591 GCCGCATCCCTGGCCTGGGAGGG 0: 1
1: 1
2: 3
3: 27
4: 251
1113885965_1113885977 13 Left 1113885965 13:113658532-113658554 CCCACTGTGTCCACGACCTTGGG 0: 1
1: 0
2: 2
3: 6
4: 129
Right 1113885977 13:113658568-113658590 GGCCGCATCCCTGGCCTGGGAGG 0: 1
1: 1
2: 3
3: 26
4: 283
1113885965_1113885973 4 Left 1113885965 13:113658532-113658554 CCCACTGTGTCCACGACCTTGGG 0: 1
1: 0
2: 2
3: 6
4: 129
Right 1113885973 13:113658559-113658581 GCCAGCTGGGGCCGCATCCCTGG 0: 1
1: 0
2: 1
3: 25
4: 276
1113885965_1113885983 25 Left 1113885965 13:113658532-113658554 CCCACTGTGTCCACGACCTTGGG 0: 1
1: 0
2: 2
3: 6
4: 129
Right 1113885983 13:113658580-113658602 GGCCTGGGAGGGCGTGAGGCAGG 0: 1
1: 0
2: 6
3: 79
4: 713

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113885965 Original CRISPR CCCAAGGTCGTGGACACAGT GGG (reversed) Intergenic
901814915 1:11788467-11788489 CCCAAGGTTTTGGAGTCAGTAGG - Exonic
901937571 1:12637023-12637045 TCCAAGGTTGTGGACATAGCAGG + Intergenic
904982974 1:34522351-34522373 ATCAAGGCCGTGCACACAGTAGG + Intergenic
906450599 1:45943433-45943455 CCCAAGGGGTTGGACACTGTTGG + Intronic
906471867 1:46137756-46137778 CCCAAGGCCTGGCACACAGTGGG + Intronic
907307051 1:53519272-53519294 CACAAGGGCGAGGACACAGGCGG - Intronic
919150974 1:193698149-193698171 CCAAAGGTAGTTGACACAGGTGG + Intergenic
919933528 1:202236647-202236669 CCCAAGGCCTGGAACACAGTAGG + Intronic
921172014 1:212558701-212558723 CCCTCGGCCTTGGACACAGTCGG - Intergenic
921612520 1:217229242-217229264 CCCTAGTGCGAGGACACAGTAGG - Intergenic
922181017 1:223232935-223232957 ACAAAGGTCAGGGACACAGTAGG + Intronic
923773313 1:236956761-236956783 CCAAAAGGCCTGGACACAGTGGG - Intergenic
924298517 1:242613081-242613103 CCCAAGATCGTGGAGAGAATGGG + Intergenic
1066005671 10:31144227-31144249 CCCAAGGGGCTGGACAGAGTGGG + Intergenic
1069599344 10:69693379-69693401 CCCAATGACAGGGACACAGTAGG + Intergenic
1069622079 10:69843806-69843828 CCTCTGGTCGTGGACACAGCAGG - Intronic
1072719745 10:97773079-97773101 CCCATGGTAGGGAACACAGTGGG + Intergenic
1072903513 10:99430372-99430394 ACCCAGGTCGTGGAGACTGTGGG - Intronic
1074521800 10:114232204-114232226 TCTAAGGTTGTGGACACAGCAGG - Exonic
1075576628 10:123582490-123582512 TCCAAGGTCAAGGACACAGGTGG - Intergenic
1076762948 10:132614715-132614737 CCCAAGGTGGTGGCCTCAGGAGG + Intronic
1083184759 11:61011002-61011024 CCCAAGGCCTGGCACACAGTAGG + Intronic
1083327170 11:61878674-61878696 CCCAAGTGTGTGGGCACAGTCGG - Intronic
1084180027 11:67441583-67441605 CCCAGGGTGGTGGGCAGAGTGGG - Intronic
1084453514 11:69253970-69253992 CCCAGGGTCCTGGACACATGAGG + Intergenic
1084461346 11:69298321-69298343 CACAAGGCCGGGCACACAGTAGG + Intronic
1085401693 11:76239581-76239603 GCCAAGGCCCTGGGCACAGTGGG - Intergenic
1096882653 12:54685356-54685378 CCCAAGGTCATAGAAAAAGTGGG - Intergenic
1099959859 12:89386501-89386523 CCCAATGTCTGGAACACAGTAGG + Intergenic
1100040600 12:90312772-90312794 CACAATGCCCTGGACACAGTAGG - Intergenic
1100282453 12:93130899-93130921 CCCAAGGTTATGGACAGAGAGGG - Intergenic
1102490677 12:113288020-113288042 CCCAAGGGAGTGGACGCAGGTGG + Intronic
1104047752 12:125174934-125174956 CCCAAGGGCATGGGCACAGCCGG - Intergenic
1107814469 13:44232017-44232039 CCCAGGGTGGTAGCCACAGTCGG - Intergenic
1110162148 13:72391131-72391153 GCCAAGGTAGTGGAGGCAGTGGG + Intergenic
1111730833 13:92074501-92074523 CCCAATGTTGTGGCCAAAGTTGG - Intronic
1113000503 13:105630421-105630443 CCCAAGTTTGGGGGCACAGTAGG + Intergenic
1113885965 13:113658532-113658554 CCCAAGGTCGTGGACACAGTGGG - Intergenic
1117022868 14:51589694-51589716 ACCATGGTCATGGACACAGTTGG - Intronic
1122803503 14:104244909-104244931 CCCAAGGCAGTGGACACTGTGGG + Intergenic
1123669524 15:22641090-22641112 CCCAATGTTGTGGCCAAAGTTGG - Intergenic
1124525499 15:30447530-30447552 CCCAATGTTGTGGCCAAAGTTGG - Intergenic
1124773155 15:32560154-32560176 CCCAATGTTGTGGCCAAAGTTGG + Intergenic
1126939714 15:53753787-53753809 CACAAGGTCTGGAACACAGTTGG - Intronic
1129166425 15:73780822-73780844 CCCAAGTTGCTGGGCACAGTGGG - Intergenic
1129242869 15:74261872-74261894 CCCAAGGCCCTGCACACAGCAGG + Intronic
1129695130 15:77736363-77736385 CCCAGGGTCTGGCACACAGTAGG - Intronic
1131814426 15:96207482-96207504 CCCAAGGACTTGGATACAGTGGG - Intergenic
1134017385 16:10898598-10898620 CCCAAGGCCTGGCACACAGTGGG + Intronic
1135405824 16:22197066-22197088 TCCAAGGTTGTAGAGACAGTTGG + Intergenic
1136124702 16:28169582-28169604 CCCAGGGTCTAGCACACAGTAGG - Intronic
1139093588 16:63678299-63678321 CCCAAGGTGGTGAATACAATGGG + Intergenic
1141780214 16:86154465-86154487 CCCAAGGCCTTGCACACAGTAGG - Intergenic
1146783339 17:35696061-35696083 CCCAAGGTCTTGGAGACCTTTGG - Intronic
1147050281 17:37789388-37789410 CCCAAGGTCCTGGACATTCTGGG + Intergenic
1148187328 17:45654166-45654188 CCCAATGCCTTGCACACAGTGGG - Intergenic
1148524381 17:48316650-48316672 TCTAAGGTCGTGCACATAGTAGG + Intronic
1149660472 17:58331878-58331900 CCCAAGGTCTTGAACACACCAGG + Intergenic
1157292985 18:46423204-46423226 CCCAAGGGCCTGGAAACATTTGG + Intronic
1158687397 18:59626952-59626974 CCCAAGACCATGGGCACAGTTGG - Intronic
1160204812 18:76823193-76823215 CGCGGGGTCGTGCACACAGTAGG + Intronic
1160204866 18:76823529-76823551 CGCTAGATCGTGCACACAGTAGG + Intronic
1160454970 18:78993549-78993571 CCCACGGACGTGGGCACGGTGGG - Exonic
1160946010 19:1644406-1644428 CCCCAGCTCCTGGACACAGAGGG - Intronic
1161508736 19:4658558-4658580 GCCAAGGGAGTGGACACAGCAGG - Intronic
1161725391 19:5925471-5925493 CCCAAGGTTGTGCCCAGAGTGGG + Intronic
1162993006 19:14315604-14315626 CCCAGTGGCGTGGACAGAGTGGG - Intergenic
1165749382 19:38251043-38251065 CCCAAGGGCGTGGGCTCAGCAGG + Intronic
1166318941 19:42004483-42004505 CCCAGGGTCTGGCACACAGTTGG - Intronic
1166521460 19:43483043-43483065 CCCAGGGTCTAGCACACAGTAGG + Intronic
927593991 2:24381134-24381156 CCCAAGGACTTAGACACTGTGGG - Intergenic
928102608 2:28448189-28448211 CCCCAGTTCCTGCACACAGTAGG + Intergenic
930853286 2:55985084-55985106 CCCAAGGACTGGGATACAGTTGG + Intergenic
932419878 2:71595469-71595491 ACCAGGGTCGGGGACAGAGTGGG - Intronic
933875689 2:86619421-86619443 CCCAAGGTCATGGAACTAGTTGG - Intronic
934561007 2:95313292-95313314 CCCAGGGTCCTGGAGACAGTGGG + Intronic
935805505 2:106743629-106743651 AGCAAGGGCGTGGACAGAGTAGG - Intergenic
935899655 2:107777612-107777634 CCCAGCGTCTGGGACACAGTAGG - Intergenic
946194311 2:218024008-218024030 GCCAAGCTCTGGGACACAGTGGG - Intergenic
948373527 2:237505482-237505504 CCCAAGGTCCAGCACACAGGCGG - Intronic
948889601 2:240900508-240900530 CCCCAGGTGCTGGCCACAGTGGG + Intergenic
1169532843 20:6504013-6504035 CCCAACGTCGCGGAGACAGCAGG - Intergenic
1172343409 20:34177707-34177729 CACAAGGTCTTGTACAAAGTTGG - Intergenic
1174202420 20:48816344-48816366 CTCCAGGGCGTGGACACAGGGGG - Intronic
1174525157 20:51164678-51164700 CCCAAGGTCATGCACATGGTAGG - Intergenic
1175368483 20:58471172-58471194 CCCAAGGTGCTGGGGACAGTGGG + Intronic
1175737520 20:61397391-61397413 CTGAAGGTCGTGAACACAGTTGG - Intronic
1178942041 21:36914421-36914443 CCCAATGCCTGGGACACAGTAGG + Intronic
1179152809 21:38822916-38822938 CCCAGGCTCGTGGACTGAGTGGG + Exonic
1182094994 22:27620095-27620117 CTCATGGTCGTGTACATAGTAGG - Intergenic
1185252615 22:49812976-49812998 CCCAAGGTCCAGGTCACAGCTGG + Intronic
950135963 3:10581122-10581144 CCCAAGGTCATGCAACCAGTAGG + Intronic
950667566 3:14506465-14506487 CCCAATGTCTGGCACACAGTAGG - Intronic
951054878 3:18136142-18136164 CCCAAGGTCACGGAGTCAGTAGG - Intronic
951578420 3:24137189-24137211 CCCAATGCCTTGTACACAGTAGG - Intronic
956064430 3:65382199-65382221 CACAATGTCTTGTACACAGTGGG - Intronic
961822407 3:129581920-129581942 CCCAGGGTTGTGTACACAGCAGG - Intronic
963236089 3:142958049-142958071 CCCAATGTCTTACACACAGTAGG + Intronic
966958709 3:184911438-184911460 ACCAAGGTTGAGGACACACTAGG + Intronic
968984281 4:3866745-3866767 ACCACGGACGTGGACACAGGAGG + Intergenic
970811867 4:20103799-20103821 CCCAAGATGGGTGACACAGTGGG + Intergenic
976158568 4:82173956-82173978 CCAAAGGTGGTGAACACATTGGG - Intergenic
979698446 4:123640524-123640546 CCCAAGGAGGTGAACACAGGTGG - Intergenic
979843019 4:125469719-125469741 GCCAATGTGGTAGACACAGTGGG - Intronic
985225998 4:187762700-187762722 TCCAAGTTCATGGACCCAGTGGG + Intergenic
999097402 5:148992227-148992249 CCCAAGGTCATGCACACAGTGGG + Intronic
1013436038 6:110108396-110108418 CCAAAGGTGGTGGACAGAGAGGG + Intronic
1016783560 6:147986351-147986373 CCCAAGGTGGAGGACAGAGATGG + Intergenic
1019271262 7:150321-150343 CCCAAGGTCGCGGAGACAGTAGG + Intergenic
1027188522 7:75985347-75985369 CCCCAGGCTGTGGACTCAGTCGG + Intronic
1031017507 7:116591725-116591747 CCCAAGGTCATAGGAACAGTTGG + Intergenic
1031139753 7:117929283-117929305 GGCAAGGTCCTGGAAACAGTAGG - Intergenic
1033505878 7:141999361-141999383 CCCAAGCTGGTGTACACTGTGGG + Intronic
1036747601 8:11420905-11420927 CCCCAGGTGATGGACACAGGTGG - Intronic
1036796291 8:11758769-11758791 CCCACGGTCTAGGCCACAGTGGG - Exonic
1043415875 8:80048498-80048520 CCCATGGAGGTGGATACAGTAGG - Intronic
1045252956 8:100496566-100496588 CCCAAGGCCATGGCCACGGTGGG - Intergenic
1045387984 8:101689654-101689676 CCCAGGGCCGGGCACACAGTGGG - Intronic
1046014163 8:108586148-108586170 CCCAAGGTCATGGAGCAAGTTGG + Intergenic
1050325959 9:4497271-4497293 CCCAAGGTCGAGGGCAGAGCCGG + Intronic
1055508854 9:76974711-76974733 CACTAGGTCTTGCACACAGTTGG + Intergenic
1056806463 9:89732764-89732786 CCCAAGGTCATGGACACGCGGGG + Intergenic
1057315220 9:93964118-93964140 CAGAAGGTGGTGGACACAGCAGG + Intergenic
1061056520 9:128225634-128225656 CCCAAGGCTGTGGACAAAGACGG + Intronic
1061116744 9:128618198-128618220 CCAAAGGTCCAGGAGACAGTAGG - Intronic
1061372010 9:130202512-130202534 CCCTAGGGCCTGGCCACAGTGGG + Intronic
1061719875 9:132544959-132544981 CCCAAGACCATGGACACAGGAGG + Intronic
1061899264 9:133664655-133664677 CCCAAGGTCAGGGCCACAGGAGG + Intronic
1062091281 9:134679898-134679920 CCCATGGTCCTGGGCAAAGTGGG - Intronic
1186361920 X:8851260-8851282 CCCAAGGTCGTGGAAACGACAGG - Intergenic
1187090138 X:16087871-16087893 CCCAAGATCTTGCACAAAGTGGG - Intergenic
1187366483 X:18669795-18669817 CCCAGGGTAGGGCACACAGTAGG + Intronic
1187408490 X:19025465-19025487 CCCAAGGCCGAGCACAAAGTAGG + Intronic
1193567333 X:83094446-83094468 CCAAAGGTCATGGTCACTGTTGG - Intergenic
1193568555 X:83111595-83111617 CCCAAGGGGTTGGACACTGTTGG - Intergenic
1195062389 X:101208967-101208989 CCCAAGGACATATACACAGTGGG - Intergenic
1197838633 X:130721660-130721682 CACACTGTCCTGGACACAGTGGG + Intronic
1199683017 X:150240419-150240441 CCCAGGGTGGGGGACACAGCAGG + Intergenic