ID: 1113886334

View in Genome Browser
Species Human (GRCh38)
Location 13:113660535-113660557
Sequence CACTCATCACACAAAGAACG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 1, 2: 4, 3: 45, 4: 203}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113886334 Original CRISPR CACTCATCACACAAAGAACG AGG Intergenic
900547518 1:3236940-3236962 CTCTCCTCACACAGAGAAGGAGG - Intronic
902446992 1:16473855-16473877 CATTCATCATACCAAGAACCAGG - Intergenic
905332895 1:37219467-37219489 CACTCACCATACCAAGAACCAGG + Intergenic
907467036 1:54645211-54645233 CACTCATCATACCAAAAACTAGG - Intronic
908135160 1:61124568-61124590 CACTGATAACACAACAAACGTGG - Intronic
908178444 1:61579508-61579530 CACTAAATACACAAAGAACTTGG + Intergenic
908290152 1:62657507-62657529 CTCTCATCATACTAAGAACGAGG + Intronic
908989583 1:70070480-70070502 CACTCATCATACCAAGAATCAGG - Intronic
911774407 1:101789698-101789720 AATTCATCACACAAAGAAGCTGG - Intergenic
913315313 1:117545503-117545525 CACTCTTTACATAAAGAAGGAGG - Intergenic
913606005 1:120466621-120466643 CACTGAAGACACAAAGAATGAGG - Intergenic
913644192 1:120840993-120841015 CACTGAAGACACAAAGAATGAGG - Intronic
914082553 1:144422591-144422613 CACTGAAGACACAAAGAATGAGG + Exonic
914087507 1:144466268-144466290 CATTCATCATACCAAGAACTAGG + Intergenic
914177451 1:145291104-145291126 CACTGAAGACACAAAGAATGAGG + Exonic
914210424 1:145573543-145573565 CACTGAAGACACAAAGAATGAGG + Intergenic
914269347 1:146065896-146065918 CACTGAAGACACAAAGAATGAGG + Exonic
914311104 1:146467935-146467957 CATTCATCATACCAAGAACTAGG - Intergenic
914349431 1:146827308-146827330 CACTCATCACACCAAGAACCAGG + Intergenic
914485231 1:148103247-148103269 CACTGAAGACACAAAGAATGAGG + Exonic
914532180 1:148532583-148532605 CACTGAAGACACAAAGAATGAGG + Exonic
914636215 1:149555138-149555160 CACTGAAGACACAAAGAATGAGG - Intergenic
915034869 1:152913106-152913128 CACTCATCACCCAGAGCACAGGG + Intergenic
915242398 1:154532664-154532686 CACTCATCATACCAAGAACCAGG - Intronic
915742504 1:158129859-158129881 CACACATCACACCAAGAACCAGG - Intergenic
916014405 1:160736138-160736160 CACTCATCATAACAAGAACCAGG + Intergenic
916471546 1:165128123-165128145 CACCCAACACTCAAAGAATGAGG + Intergenic
917471980 1:175333864-175333886 CACTCACCACACAAGGAATGTGG + Intronic
917991687 1:180386945-180386967 TACTCATCATACCAAGAACCTGG - Intronic
918034433 1:180853552-180853574 CACTAGTCATACAAAGAACAAGG - Intronic
918901938 1:190433433-190433455 CACTCATCAGAAAAAGGACTTGG - Intronic
919013497 1:191996615-191996637 TACTCATCATACAAAGAACCTGG + Intergenic
921787503 1:219248337-219248359 CTCTCATCTCACAAAGAGCCAGG - Intergenic
921830178 1:219719080-219719102 CACTCACCACACCAAGAACCAGG + Intronic
923280259 1:232436723-232436745 CACTCAACACACAGAAAACAAGG + Intronic
1063878316 10:10505074-10505096 CAGTCATCATAAAAAGAACCAGG - Intergenic
1063916165 10:10884820-10884842 CACTCAACACAAAAAGACCAAGG - Intergenic
1066105668 10:32154763-32154785 CACTCATCATACCAAGAACCAGG - Intergenic
1067227085 10:44383406-44383428 CACCCATAACTCAAAGACCGAGG + Intronic
1067245449 10:44537924-44537946 CACTCATCTTACTAAGAACCAGG - Intergenic
1070352395 10:75605763-75605785 AACTGCTCACACAAAGAACTTGG - Intronic
1070868846 10:79730135-79730157 CAGTAATCACTCAAAGAATGGGG + Intergenic
1071246554 10:83771184-83771206 CATCCATCATACAAAGAATGAGG + Intergenic
1071484466 10:86089532-86089554 CACTATTCACACAAAGATCCAGG + Intronic
1071635761 10:87252317-87252339 CAGTAATCACTCAAAGAATGGGG + Intergenic
1071659482 10:87485622-87485644 CAGTAATCACTCAAAGAATGGGG - Intergenic
1073039139 10:100587640-100587662 CACTCATCATACCAAGAACCAGG + Intergenic
1075529574 10:123218116-123218138 CACTCCTCATACCAAGAACCAGG - Intergenic
1076311541 10:129511303-129511325 TTCTCATCACAGAAAGCACGTGG - Intronic
1077338855 11:2017196-2017218 GACTCCTCACACACAGAGCGTGG - Intergenic
1079061305 11:17251331-17251353 CACTCATCTGACAAGGAAAGAGG - Intronic
1085338192 11:75713524-75713546 CACTGAACACACAAACAATGTGG - Intergenic
1085369135 11:75982077-75982099 CACTCACCACACCAAGAACCAGG - Intronic
1085665005 11:78406692-78406714 GACTCATTATACAAAGAATGAGG + Intronic
1086344479 11:85882225-85882247 CACTCATCATACCAAGAACCAGG - Intronic
1086902555 11:92384119-92384141 TTCCCATCACACAAAGAAGGAGG - Intronic
1086986101 11:93251083-93251105 CAGTGAACACACAATGAACGAGG - Intergenic
1087627336 11:100610239-100610261 TACTCATCACACCAAAAACCAGG + Intergenic
1089287838 11:117419225-117419247 CCCTCTTCACACAAAGAAAGAGG - Intergenic
1202821839 11_KI270721v1_random:72378-72400 GACTCCTCACACACAGAGCGTGG - Intergenic
1096635203 12:52953806-52953828 CACCCATCACTCAAAGACCTAGG + Intergenic
1101543630 12:105688763-105688785 CACTCATTACACCAAGAATTAGG - Intergenic
1105331866 13:19425163-19425185 CACTCAAGACACAAAGGAGGAGG + Intronic
1105500440 13:20966904-20966926 CATCCATCACACCAAGAACTAGG + Intergenic
1105879945 13:24595624-24595646 CACTCAAGACACAAAGGAGGAGG - Intergenic
1113201599 13:107872486-107872508 CACTCAAGATACACAGAACGAGG + Intergenic
1113694782 13:112336864-112336886 CACTCATCATACTAAGAATCTGG + Intergenic
1113886334 13:113660535-113660557 CACTCATCACACAAAGAACGAGG + Intergenic
1117701210 14:58415324-58415346 CACTCATCACACCAAGAACTAGG + Intronic
1118537501 14:66783979-66784001 CAGTCATCATACCAAGAACAAGG + Intronic
1123705596 15:22948559-22948581 TACTCAGCACACAAAGAACGAGG + Intronic
1123942109 15:25221676-25221698 GACTCATCAGAGAAAGAATGTGG + Intergenic
1124002600 15:25771272-25771294 CAATCATAACACAAAGAGCCCGG + Intronic
1124271211 15:28282290-28282312 CACTCATGATACCAAGAACCAGG + Intronic
1125691635 15:41600691-41600713 CACTCATCACTCAGAGGATGAGG + Intergenic
1127040064 15:54965080-54965102 CTTTCATGACACAAAGAACCTGG + Intergenic
1128867664 15:71126557-71126579 CACTCATCACACTGAGAACCAGG + Intronic
1129034260 15:72640170-72640192 CACGCAGCACACAAAGTGCGTGG + Intergenic
1129215622 15:74097046-74097068 CACGCAGCACACAAAGTGCGTGG - Intergenic
1129550634 15:76445367-76445389 CACTCATCATAGAAAGAACCAGG - Intronic
1129732758 15:77941375-77941397 CACGCAGCACACAAAGTGCGTGG - Intergenic
1130768803 15:86903532-86903554 CACTCATCATACCAAGAATCAGG - Intronic
1137782044 16:51105712-51105734 CACTTAGCACACAAAGAAGCTGG - Intergenic
1137908714 16:52353736-52353758 TACTCATCACACCAAGAAACAGG - Intergenic
1138116786 16:54367305-54367327 CACTAATCACAGGAAGAAGGTGG - Intergenic
1139984605 16:70888246-70888268 CACTCATCATACCAAGAACCAGG - Intronic
1143954471 17:10657621-10657643 CGCTCATCACACCCTGAACGCGG + Intergenic
1144152793 17:12466620-12466642 CACCTATCACACAAAGAACTAGG - Intergenic
1144434811 17:15231063-15231085 CACTCATCACGCACAGACCTGGG + Exonic
1144792965 17:17871761-17871783 CACTCTTCACTCAGAGAATGGGG + Intronic
1145045863 17:19615290-19615312 CACCCATCCCACCAAAAACGAGG + Intergenic
1146666207 17:34705704-34705726 CACTCATCCCATAAAGAAGAAGG + Intergenic
1147473586 17:40687554-40687576 CACTCATCTCAAAAAGAACCAGG - Intergenic
1148908891 17:50929375-50929397 CACTTGTAACACATAGAACGTGG - Intergenic
1149883952 17:60321481-60321503 CACTCAGCACATAAAGAACCAGG + Intronic
1150674950 17:67237037-67237059 CACTCAAGAAACAAAGAACCTGG + Intronic
1151497862 17:74469960-74469982 CACACAACACAGAAAGAACCAGG - Intronic
1153535779 18:6100523-6100545 CACTCATTATACCAAGAACCAGG - Intronic
1155112973 18:22734669-22734691 CACTCATCATACCAAGAACAAGG + Intergenic
1155202168 18:23526875-23526897 CACCCCTCACATAAAGAATGAGG - Intronic
1156172711 18:34505872-34505894 CATTCATCATACCAAGAACCGGG - Intronic
1156235933 18:35204788-35204810 CACTCAACATACCAAGAACCAGG + Intergenic
1156276527 18:35588940-35588962 CACTCATCATACCAAGAGCCAGG - Intronic
1158909744 18:62047787-62047809 CACTCACCACATCAAGAACCAGG + Intronic
1159033943 18:63259266-63259288 CCCCCATCACAGAAAGAAAGCGG + Intronic
1159504279 18:69314796-69314818 CTGTCATCACTCAAAGAATGAGG + Intergenic
1160251769 18:77209754-77209776 CACTCAGCATACCAAGAACTAGG - Intergenic
1160317898 18:77865552-77865574 CACTCATCATCCCAAGAACCAGG - Intergenic
1162342995 19:10102965-10102987 CACACACCACACATAGAAAGAGG + Intergenic
1166581539 19:43904291-43904313 CACTTACCACACCAAGAACTGGG + Intergenic
927614658 2:24580825-24580847 CACTCATCATACCAAGATCCAGG - Intronic
928499047 2:31868520-31868542 CACACATCACATAAAAAACTGGG + Intronic
930155187 2:48099467-48099489 CACTTATCATACAAAGAACCAGG + Intergenic
933871815 2:86573831-86573853 CACTCATCATACCAAGAACCAGG + Intronic
934530671 2:95085815-95085837 CACTCATCATAACAAGAACTAGG + Intergenic
934564014 2:95328488-95328510 CACTGATCTCACAAAGGAAGTGG + Intronic
935055432 2:99562682-99562704 CACTCATCATACCAAGAACTAGG - Intronic
935061396 2:99611343-99611365 CACTCATCATACCAAGAACCTGG - Intronic
935097814 2:99962371-99962393 CACCCATCATACCAAGAACCAGG + Intronic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
935475376 2:103514487-103514509 CACTTCTCATACAAAGAACAAGG - Intergenic
935624317 2:105156733-105156755 CACTCATTATACAAAGAATTGGG + Intergenic
936641605 2:114317991-114318013 TACTCATCACAGCAAGAACCAGG - Intergenic
938061117 2:128254946-128254968 CACTCATCATATCAAGAACCAGG + Intronic
940628160 2:156202852-156202874 CACATATCACACCAAGAACCAGG - Intergenic
942687359 2:178547494-178547516 CACTCATCTCACAAAATACATGG - Exonic
943181263 2:184544794-184544816 CACCCCTAACACAAAGAACATGG + Intergenic
943647806 2:190426761-190426783 CATTCGTCACACCAAGAACCAGG - Intronic
944085245 2:195838313-195838335 TACTCAACACACAAAGAATAAGG + Intronic
944157607 2:196623772-196623794 TACTCAACATACAAAGAACCAGG + Intergenic
946151763 2:217778407-217778429 CACTCATCATACCAAAAACCAGG + Intergenic
947007738 2:225531333-225531355 CACTCATCCCTCAAGGAACAGGG + Intronic
947598024 2:231426267-231426289 CACACATCACAGCAAGAAGGAGG + Intergenic
947817355 2:233047209-233047231 CCCTCATTTCACAAAGAAAGAGG + Intergenic
948447928 2:238047740-238047762 CACTCATCATACCAAGAACCAGG + Intronic
948514122 2:238492866-238492888 CCCTCATCATACCAAGAACCAGG - Intergenic
948771045 2:240251407-240251429 CCCTCATCCCACACAGAAGGAGG + Intergenic
1169020088 20:2324409-2324431 CACTCAACAAACAAAGAACCAGG - Intronic
1170330769 20:15208455-15208477 CACTCATTATACCAAGAACCAGG - Intronic
1171321643 20:24249280-24249302 CACTCATCACACAAAGAACCAGG + Intergenic
1174413925 20:50354716-50354738 CAGTCATCACACTAATAACGAGG + Intergenic
1176337978 21:5616563-5616585 CACTCCTCACATTAGGAACGAGG - Intergenic
1176339386 21:5679636-5679658 CACTCCTCACATTAGGAACGAGG - Intergenic
1176343483 21:5719452-5719474 AACTCATTACAAAAAGAACTAGG - Intergenic
1176471640 21:7111789-7111811 CACTCCTCACATTAGGAACGAGG - Intergenic
1176495201 21:7493567-7493589 CACTCCTCACATTAGGAACGAGG - Intergenic
1176501344 21:7605004-7605026 AACTCATTACAAAAAGAACTAGG + Intergenic
1176505441 21:7644820-7644842 CACTCCTCACATTAGGAACGAGG + Intergenic
1176537804 21:8117521-8117543 AACTCATTACAAAAAGAACTAGG - Intergenic
1176741138 21:10603393-10603415 CACTCAAGACACAAAGGAGGAGG - Intronic
1179832873 21:44009163-44009185 CACTAAACATACAAAGAAAGAGG - Intergenic
1180916515 22:19492643-19492665 TACTCATCATACCAAGAACTAGG - Intronic
1182162304 22:28135038-28135060 CACTCATCATACCAAGAACTAGG - Intronic
1182444346 22:30381308-30381330 CACTCATTCCACAAAGATGGTGG - Intronic
1183048960 22:35245580-35245602 CACTCATCCTACCAAGAACCAGG - Intergenic
1183733341 22:39630271-39630293 CACTTTTCACCCAACGAACGAGG + Intronic
1184947123 22:47811382-47811404 CACTCAGCACACACAGAAGCAGG - Intergenic
1185092269 22:48782455-48782477 CAGTCATCACAACAAGAAGGGGG - Intronic
1203242750 22_KI270733v1_random:33876-33898 AACTCATTACAAAAAGAACTAGG - Intergenic
952907015 3:38146516-38146538 CAGTCATCATACCAAGAACTAGG + Intergenic
953512240 3:43554157-43554179 CACTCATCATAGAAAGAACCAGG - Intronic
953539068 3:43798409-43798431 CACTCATAACACCAAGAATCAGG + Intergenic
955047183 3:55371634-55371656 CACTCATCATACAAAGAGCCAGG - Intergenic
956262718 3:67362708-67362730 CAGTCATCACACACAAAAGGTGG - Intronic
956543650 3:70374313-70374335 CACTCATCATACCAAGAACAAGG - Intergenic
957202780 3:77158535-77158557 TACTCATCACATAAAGAATAGGG + Intronic
958499955 3:94892637-94892659 CAGTCATAACCCAAAGAACAAGG - Intergenic
959624895 3:108438646-108438668 CTCACATCACACAAGGAACAAGG - Intronic
959844550 3:111018393-111018415 CATTCTCAACACAAAGAACGTGG + Intergenic
960816690 3:121680308-121680330 CACTCATCATACCAAGAACCAGG + Intronic
963712973 3:148768501-148768523 CACTCATCATACCAAGAAGCAGG + Intergenic
966642676 3:182208293-182208315 CACTCCTCAGAAAAAGAAGGAGG + Intergenic
970971364 4:21988039-21988061 CCCTCATCACACAATGAACAGGG - Intergenic
976689784 4:87856262-87856284 CACTCATCATTCAAAGAAACAGG + Intergenic
978873215 4:113605925-113605947 CACTCATCATATCAAGAACCAGG + Intronic
980032273 4:127844843-127844865 CATTCCGCACACAAAGAACTTGG + Intergenic
982197969 4:152935487-152935509 CACTCCTCACAGAAAGAAACAGG - Intergenic
982579199 4:157156825-157156847 CACTCATCATACAAAAAACTGGG - Intronic
983058749 4:163130209-163130231 TGCTCATCACAAAAAGAACCAGG + Intronic
983193107 4:164775348-164775370 CATTCATGAGACAAAGAACAAGG - Intergenic
983985020 4:174048999-174049021 CTCTCAGTAAACAAAGAACGGGG - Intergenic
987143150 5:14966005-14966027 CACTAATCACACCAAGAACCAGG - Intergenic
987186837 5:15430317-15430339 CACTCATCATACCAAGAACCAGG - Intergenic
987673102 5:21039419-21039441 CACACATCAAACAGAGAAAGTGG + Intergenic
992208431 5:74453373-74453395 CACTCATGACACCAAGAATCAGG + Intergenic
996187739 5:120499798-120499820 CACTCATCACACCAAGAACCAGG - Intronic
999856654 5:155602004-155602026 CACTCATAACATCAAGAACCCGG - Intergenic
1001531884 5:172469129-172469151 CACTTATCATACCAAGAACCAGG - Intergenic
1002171325 5:177376278-177376300 CACACAGCAGACAAAGAACTGGG + Intergenic
1003028005 6:2576013-2576035 TACTCATCATACTAAGAACCAGG - Intergenic
1007600517 6:43077911-43077933 CACACATCACAAGAAAAACGGGG - Intronic
1008955876 6:57214791-57214813 CACTCAGCACACCAAGAACCAGG + Intronic
1009416428 6:63420740-63420762 CATTCATCATACCAAGAACCAGG + Intergenic
1010379409 6:75207852-75207874 CACCCAACACACAAAGAGCAGGG + Intergenic
1012860373 6:104551895-104551917 TACTCATCATACCAAGAACCAGG + Intergenic
1014050000 6:116940873-116940895 AAATCATCACACAAATAATGTGG - Intergenic
1018713847 6:166516570-166516592 CACACATCACACAGCCAACGGGG + Intronic
1018738791 6:166711370-166711392 CACTAATTACACAAAGAACCAGG + Intronic
1020510502 7:9050325-9050347 CACTCATTATACCAAGAACCAGG + Intergenic
1021017609 7:15553931-15553953 CCCTCAAGACACAAAGAAAGAGG + Intronic
1021145562 7:17084640-17084662 TAATCATCCCACAAAGAACAAGG - Intergenic
1022842247 7:34175777-34175799 CACTCATCATATCAAGAACCAGG - Intergenic
1023586174 7:41732144-41732166 CACTCAGCACACACTGAAAGCGG - Intergenic
1025256547 7:57387480-57387502 CAGTCATCACACTAATAACGAGG - Intergenic
1026605885 7:71815524-71815546 CAACCATCCCACAAAGGACGCGG + Intronic
1028582786 7:92424495-92424517 CACAGATCACACTCAGAACGGGG - Intergenic
1030615187 7:111731387-111731409 AGCTCATCACACAAAGGACATGG + Intronic
1030652604 7:112131779-112131801 CACTAATGACACAAAAAAGGAGG + Intronic
1033552154 7:142457399-142457421 TACTCAACACACAAAAAATGAGG - Intergenic
1033896095 7:146072529-146072551 CACTAATTATACAAAGAAAGAGG - Intergenic
1034529131 7:151684483-151684505 TACTCATCACACAAAGCCCACGG - Intronic
1035793581 8:2331974-2331996 CATTCATCATACCAAGAACCAGG - Intergenic
1035799222 8:2389731-2389753 CATTCATCATACCAAGAACCAGG + Intergenic
1038110807 8:24495234-24495256 CACTCTTCAAACAAAGAACCAGG + Intronic
1039331885 8:36546785-36546807 CAATTATCACCCAAAAAACGAGG + Intergenic
1040613356 8:49009148-49009170 CACTCATCATATCAAGAACCAGG - Intergenic
1041122320 8:54599785-54599807 CACTCATCATACCAAGAACAAGG - Intergenic
1044386733 8:91597990-91598012 TACTAATCTCACAAAGAATGAGG - Intergenic
1047594159 8:126359961-126359983 CACACATCATACCAAGAACCGGG + Intergenic
1047908723 8:129501961-129501983 CACTTATCACACCAAAAACCAGG + Intergenic
1049264021 8:141657052-141657074 TACTCATCATACCAAGAACCAGG - Intergenic
1051158476 9:14178134-14178156 TACTCATCTTACAAAGAATGAGG - Intronic
1052049886 9:23832554-23832576 CACTTAAGACACAAAGAACAAGG - Intergenic
1055580829 9:77704830-77704852 CACTCATCATGCTAAGAACTAGG - Intergenic
1055800606 9:80032109-80032131 CACTCATCAAAAAAGGAATGGGG + Intergenic
1056847320 9:90051965-90051987 CACTCATCATACCAAGCACCAGG - Intergenic
1056878574 9:90365182-90365204 CACTCATAATACCAAGAACTAGG - Intergenic
1057043803 9:91867997-91868019 TACTCAACATACAAAGAACCAGG + Intronic
1057830752 9:98404721-98404743 CCCTCATCACACAAAGAAATTGG + Intronic
1059379800 9:113914174-113914196 TTCTCATCACAGAAAGAACCGGG - Intronic
1060050172 9:120373039-120373061 TACTGATCCCAGAAAGAACGAGG + Intergenic
1060782181 9:126420918-126420940 CACTTATCACATAAAGTAAGTGG - Intronic
1061809893 9:133156116-133156138 CACTCAGCACAGGAAGAAGGAGG + Intronic
1062338464 9:136082800-136082822 CAGTCAACACCCAGAGAACGGGG - Intronic
1062719728 9:138033430-138033452 CACTTATCACACCAAGAACCAGG - Intronic
1203459076 Un_GL000220v1:16959-16981 AACTCATTACAAAAAGAACTAGG - Intergenic
1188018975 X:25136553-25136575 CACTCATTATACAAAGAACTAGG - Intergenic
1189355816 X:40309184-40309206 CACTTGTAACCCAAAGAACGTGG + Intergenic
1189870882 X:45381625-45381647 CACCAAACACGCAAAGAACGAGG + Intergenic
1189963276 X:46345182-46345204 CACTCATCATATCAAGAACCAGG + Intergenic
1190032714 X:46990214-46990236 CACTCATCATACTAAGAACTGGG - Intronic
1190256019 X:48762730-48762752 TAGTCATCACACAAAGGACTGGG - Intronic
1190751990 X:53370117-53370139 CACTCATCAAACCAAGAACTAGG + Intergenic
1191875721 X:65794003-65794025 CACTCATCATACCAACAACCAGG - Intergenic
1192019772 X:67375598-67375620 CCCTCATCACATAAATAACCTGG - Intergenic
1192361116 X:70440177-70440199 CACTCATTATACCAAGAACCAGG + Intergenic
1192548765 X:72037011-72037033 CACTCATCATATCAAGAACCAGG - Intergenic
1195744907 X:108107559-108107581 CACTCATGATAAAAAGAACCAGG - Intronic
1196138997 X:112239922-112239944 CACTCATTATACCAAGAACCAGG + Intergenic
1196510501 X:116505670-116505692 CACTAATTACACTAAGAACCAGG - Intergenic
1198220569 X:134597516-134597538 CATTCATCATACCAAGAACCAGG - Intronic
1198325232 X:135564762-135564784 CACTCATCATACCAAGAACCAGG - Intronic
1198714213 X:139539105-139539127 AACTCATCACATAAAGAGCCTGG + Intronic
1202599398 Y:26577255-26577277 CACTCAAGACACAAAGGAGGAGG - Intergenic