ID: 1113886486

View in Genome Browser
Species Human (GRCh38)
Location 13:113662859-113662881
Sequence CAATCTCCCCAAATTGATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113886486 Original CRISPR CAATCTCCCCAAATTGATAT AGG Intergenic
900633017 1:3647953-3647975 CAATTTCCTCAAATTTATAAAGG + Intronic
901643899 1:10706518-10706540 CAATCCCCCCAATCTGATTTGGG - Intronic
906832510 1:49048046-49048068 CATTCTCCCCAAATACAAATCGG - Intronic
907664726 1:56424745-56424767 CAATCTCCTTAAAATGATGTAGG - Intergenic
908868376 1:68578127-68578149 CAATCCCCCAAAATTGAACTAGG + Intergenic
911511382 1:98810728-98810750 CAATCTCCCCAGATTGAATCAGG + Intergenic
915358677 1:155272590-155272612 CAACCTCCCCAAATTGAGGAGGG + Intronic
918019941 1:180677597-180677619 GAACCTCCCCAAATTGCTCTTGG - Intronic
921748887 1:218769621-218769643 CAACCTCCATAAATTGAAATAGG + Intergenic
1062935858 10:1388225-1388247 AAATTTCCTCAAATTGATACAGG + Intronic
1068314595 10:55323634-55323656 CAATTTCTCCAATTTGAAATGGG + Intronic
1070446031 10:76503540-76503562 CAATCTCCCAAGATTGATCCAGG - Intronic
1070461213 10:76672295-76672317 CAGTCTCCTCACAGTGATATAGG - Intergenic
1071186664 10:83054155-83054177 GAATCTCCCCAAATTGCTTCTGG + Intergenic
1074248635 10:111720407-111720429 CATTCTCCTCAAATTCATATGGG + Intergenic
1079884760 11:25973243-25973265 AAATCTCCCCAAATTGCTTCTGG + Intergenic
1079991578 11:27252025-27252047 CAATCTCCTCAAAATGACTTTGG - Intergenic
1080996176 11:37605013-37605035 CAACTTCCCAAAATTGAAATAGG + Intergenic
1081240086 11:40694781-40694803 CACACTGCACAAATTGATATAGG + Intronic
1082026150 11:47573775-47573797 CATTCTCCCCAATTTCCTATTGG + Exonic
1086133514 11:83423904-83423926 GAATCTCCCCAAATTGCTCCTGG + Intergenic
1087146544 11:94818960-94818982 CAATCCCGGAAAATTGATATAGG - Intronic
1088733218 11:112702596-112702618 CAATCTCCCAAGATTGAATTAGG + Intergenic
1091516738 12:1191587-1191609 CCATCTCCCAAAATCAATATTGG - Intronic
1093101073 12:15029944-15029966 GAACCTCCCCAAATTGCTCTGGG - Intergenic
1095107789 12:38256605-38256627 CAATCTCCACAGATTGAATTGGG - Intergenic
1097820056 12:64119451-64119473 AATTCTCCCCATATTAATATAGG - Intronic
1098408652 12:70154390-70154412 AAATCTCCCCAAATTGCTTCTGG - Intergenic
1099048496 12:77754219-77754241 CACTCTCCTCAAGCTGATATTGG + Intergenic
1102614954 12:114145512-114145534 CAATCTCCCTGAAATGATCTTGG - Intergenic
1106931808 13:34674517-34674539 GAATGTCCCCAAATTGATCCTGG + Intergenic
1108097536 13:46919477-46919499 GAATCTCCCCAAATTGAATCAGG - Intergenic
1108134373 13:47339432-47339454 GAACCTCCCCAAATTGCTCTTGG + Intergenic
1109668758 13:65575248-65575270 GTTTCTCCCCAAAATGATATAGG - Intergenic
1110739675 13:78979832-78979854 TTATCACCCTAAATTGATATTGG + Intergenic
1113886486 13:113662859-113662881 CAATCTCCCCAAATTGATATAGG + Intergenic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1118109290 14:62697934-62697956 GAATGTACCCAACTTGATATAGG + Intergenic
1120625060 14:86814747-86814769 CAATCTCCCAAAATTGAATTAGG - Intergenic
1121860732 14:97315530-97315552 CAATCTCCCCATCTGAATATGGG + Intergenic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123571335 15:21613053-21613075 CAATCTCCTAAAATTGAATTAGG - Intergenic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1123607449 15:22048404-22048426 CAATCTCCTAAAATTGAATTAGG - Intergenic
1126835324 15:52658055-52658077 CACTGTCTCCAAATAGATATTGG + Intronic
1127127192 15:55823148-55823170 CAATGTCCCCAGATGGAGATAGG + Intergenic
1127929946 15:63588286-63588308 CAATCTAAACAAATTGATTTTGG - Exonic
1131976729 15:97954246-97954268 CCATCTCCCCAAAATGATTCTGG - Intergenic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1133408286 16:5544864-5544886 CAATCTCTAAAACTTGATATAGG - Intergenic
1136777173 16:32878259-32878281 CAAGCTCACACAATTGATATTGG + Intergenic
1136893449 16:33983254-33983276 CAAGCTCACACAATTGATATTGG - Intergenic
1141918551 16:87119067-87119089 CTACCTCCCCAAATTGTTATTGG - Intronic
1203079587 16_KI270728v1_random:1140368-1140390 CAAGCTCACACAATTGATATTGG + Intergenic
1144577393 17:16437605-16437627 CACTCTCCCCAAATTCATGCAGG + Intergenic
1145003952 17:19326180-19326202 GCTTCTCCCCAAATTGATCTTGG + Intronic
1148343277 17:46886285-46886307 CCATCCCCACCAATTGATATAGG - Intronic
1149408544 17:56380066-56380088 GATTCTCCCCAAATTAATTTAGG - Intronic
1151299629 17:73214060-73214082 CAATCTTCTCAAAATCATATTGG - Intronic
1153271324 18:3324876-3324898 CAATATCCTAAAATTGATTTAGG + Intergenic
1153305835 18:3629935-3629957 AAAGCTTCCCAAAATGATATGGG - Intronic
1153991077 18:10401207-10401229 CAATCCCTACAAATGGATATGGG - Intergenic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1154496656 18:14966214-14966236 CAATTTGCCCAAATTCACATGGG + Intergenic
1156426282 18:37016679-37016701 CAATCTCCCAAAATTGAATCAGG - Intronic
1156676859 18:39537594-39537616 CTATCTCCCCAGATTGCTGTGGG - Intergenic
1156794148 18:41021473-41021495 TAATTTCCCAAAATTGATAGTGG - Intergenic
1159320571 18:66842325-66842347 CAACCTCCCAAAATTGAAACAGG + Intergenic
928528734 2:32168884-32168906 CACTCTTCCCAAAATTATATTGG - Intronic
929350362 2:40943728-40943750 CAAGCTTCCCCAAATGATATAGG + Intergenic
929356306 2:41028983-41029005 CAATCTCCCAAAATTGCAAAAGG + Intergenic
930113488 2:47698743-47698765 CAACCTCCCCAAATTGCTTCTGG + Intronic
932470954 2:71956713-71956735 CAATCTCCCAAAATTGAGTCAGG + Intergenic
932960187 2:76404460-76404482 CAAGCTTCCAAAATTGATAGAGG + Intergenic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
939313975 2:140522821-140522843 CAATCTCCCAAAATTGAGTAAGG + Intronic
939405259 2:141747181-141747203 CAATTACCACAAGTTGATATGGG + Intronic
940408395 2:153331887-153331909 CAATCTCCCAAGATTGAAACAGG - Intergenic
942296460 2:174522081-174522103 CAATCTCTCGACATTGAAATGGG + Intergenic
945660211 2:212676544-212676566 CAATCTCCCAAGATTGAATTAGG - Intergenic
947216214 2:227752671-227752693 AAACCTCCCCAAATTGTTCTTGG + Intergenic
948965584 2:241377252-241377274 CAGATTCCCCAAGTTGATATTGG + Intronic
1170065200 20:12303293-12303315 CAATTTCCCCCACTTGAAATGGG - Intergenic
1171216452 20:23356129-23356151 CACACACCCCAAATTGATAATGG - Intergenic
1171946302 20:31380995-31381017 AATTCTCCTCAAATTGACATAGG - Intronic
1174527361 20:51184315-51184337 AAATCCCCCCAAATTGAAATTGG + Intergenic
1175591311 20:60194084-60194106 CAATTTCCCCAAAGGGAGATGGG + Intergenic
1176690338 21:9900607-9900629 CAATCTTTCCAAATTGTAATCGG + Intergenic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1176960030 21:15148926-15148948 CAATGCTCCCAAATTGATTTTGG - Intergenic
1177474123 21:21596297-21596319 CAATCTCCCAAGATTGAAAAAGG - Intergenic
1178042875 21:28659911-28659933 AATTCTCCCCAAATTGATTTAGG - Intergenic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
1184917852 22:47585165-47585187 CAATCCCGGAAAATTGATATAGG - Intergenic
949345950 3:3076812-3076834 CCATCTCACAAAGTTGATATAGG + Intronic
950919826 3:16683195-16683217 CAATCTTGAAAAATTGATATAGG - Intergenic
951139931 3:19147836-19147858 CCTTCTCCCCAAATTGCCATTGG - Intergenic
952000182 3:28776159-28776181 CTATCTCCCCAATTTGAGAGAGG - Intergenic
952628507 3:35437473-35437495 GAATCTCCCCAAATTGCTCCTGG + Intergenic
954824181 3:53356916-53356938 CAAGCTCTCAAAATAGATATTGG + Intergenic
954983332 3:54766284-54766306 GAAACTCCCAAAATTGCTATAGG + Intronic
956508471 3:69968572-69968594 AAATCTCCCCAAATTCAGAGGGG - Intergenic
959576222 3:107937193-107937215 CAATCTTGCAAAATTGCTATAGG + Intergenic
961799505 3:129435107-129435129 CAATCATCCCAAAATGATACTGG + Intronic
962895743 3:139713143-139713165 CAATGGCACCAATTTGATATGGG + Intergenic
962984785 3:140525371-140525393 CAATCTCCCAAGATTGAACTAGG + Intronic
964456413 3:156872155-156872177 CAACCTCCCAAAATTGAATTAGG - Intronic
964936079 3:162089635-162089657 CAATTTCTCCAAAGTGATAAGGG - Intergenic
964991770 3:162821452-162821474 CAATCTCACCAAATTCAATTTGG + Intergenic
965846623 3:172969665-172969687 CAATCTACCAAAATTGCTCTAGG - Intronic
966533910 3:181009667-181009689 GACTCTCCCCAAATTGCTCTGGG - Intergenic
971554130 4:27990661-27990683 AAATTTCCTCAAATTGATAAGGG - Intergenic
973805163 4:54518707-54518729 CAGTCTCACAAAATTCATATTGG - Intergenic
975052496 4:69883291-69883313 CAATTTCTCCAATTTGAAATAGG - Intergenic
975809445 4:78151292-78151314 CCATTTCCCCAAGTTGAGATAGG + Intronic
977634431 4:99280819-99280841 TTATCTCCCCAAATATATATAGG + Intronic
977720289 4:100231623-100231645 CAATCCTGCAAAATTGATATAGG + Intergenic
978405992 4:108379204-108379226 CAATGGTCCCAAATTGATAGAGG + Intergenic
979869997 4:125807239-125807261 CAAACTCCAGAAATTTATATTGG - Intergenic
980226447 4:129993190-129993212 GAATCTCCCCAAATTGCTCCTGG + Intergenic
980555810 4:134402599-134402621 CAATCTCCCAAGATTGAATTAGG - Intergenic
980771021 4:137373318-137373340 CAAACTCCCCAAAGTAATGTGGG - Intergenic
983598966 4:169502167-169502189 CAATCTCCCAAGATTGAACTAGG + Intronic
983749058 4:171241359-171241381 AAATCTCCCCAAGTTAATATAGG + Intergenic
988726135 5:33928247-33928269 GAATCTCCCCAAATTGCTGATGG - Intergenic
989299482 5:39872536-39872558 CAATCTCCCAAGATTGAATTTGG - Intergenic
990237795 5:53786563-53786585 GAATCTCCCCAAATTGCTCCTGG + Intergenic
990628961 5:57646483-57646505 CAATCTCCCAAAATTGAACCAGG - Intergenic
991071219 5:62483045-62483067 TATTTTCCCCAAATTCATATTGG - Intronic
991510443 5:67370834-67370856 CAATCTCCCCCATTAGATTTTGG + Intergenic
992001087 5:72437281-72437303 CAATCACCCCAGAGTGTTATTGG - Intergenic
992286653 5:75242359-75242381 GAATCTCCCCAAATTGCTTCTGG - Intergenic
993280028 5:85913656-85913678 CAATCTCCCAAAATTGAATCAGG + Intergenic
993664874 5:90683707-90683729 CAATATCTCCACAGTGATATTGG - Exonic
994172736 5:96676072-96676094 AAATCTCCCCACTTTGAGATGGG + Intronic
997014947 5:129921777-129921799 CAATTACCCTGAATTGATATAGG - Intronic
997753340 5:136371292-136371314 CAATTTCCCAAAAATGCTATAGG + Intronic
997774755 5:136592356-136592378 CAATCTCCCAAGATTGATCTAGG - Intergenic
998202631 5:140137370-140137392 CCAACTTCCCAAATGGATATGGG - Intergenic
998509148 5:142696932-142696954 CCATATCCCTAAATGGATATAGG + Intronic
998989146 5:147795877-147795899 CCATCTGCCCAAATGTATATGGG - Intergenic
999032791 5:148312874-148312896 TAATCCCCCCAAACTGATTTGGG - Intronic
1003664386 6:8096488-8096510 CATTTTCCCCAAAGTGATAAAGG + Intronic
1012322969 6:97874635-97874657 CTACCTCCCCAAAATAATATTGG + Intergenic
1017115436 6:150971869-150971891 CATTTGCCCCAAATTGATCTTGG + Intronic
1017921222 6:158873935-158873957 CAATCTCACTAAACTGACATTGG + Intronic
1018188992 6:161292071-161292093 GAACCTCCCCAAATTGTTCTTGG + Intergenic
1018759290 6:166876873-166876895 CAATCTCACCAAATTGACGCAGG + Intronic
1021216053 7:17916583-17916605 CAAACTCCCAAAATTGAACTAGG + Intronic
1022209639 7:28195840-28195862 CATACTTCCCAAATTGATATTGG + Intergenic
1022437109 7:30398897-30398919 CAAACTCTTCAAATTGACATGGG - Intronic
1022566303 7:31406200-31406222 CAGTCTTCCCACATTCATATCGG - Intergenic
1023678681 7:42660044-42660066 AATTCTCCTCAAATTGATCTAGG + Intergenic
1025521949 7:61745843-61745865 TAAAATCTCCAAATTGATATTGG - Intergenic
1025545679 7:62164133-62164155 TAAAATCTCCAAATTGATATTGG - Intergenic
1029947600 7:104549716-104549738 CAAGGTCCCCAGATAGATATAGG - Intronic
1030194989 7:106844534-106844556 CAACCTCCCCAAATTGCTCCTGG - Intergenic
1033984701 7:147210307-147210329 CAATCTCCCAAGATTGAATTAGG - Intronic
1038470563 8:27814247-27814269 CAATTTACCAAAATTAATATAGG - Intronic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1041578467 8:59428238-59428260 CAGTCTGCCCAAATTCAAATTGG - Intergenic
1043626229 8:82262551-82262573 AAATTTCCCCAACTTGATAAAGG - Intergenic
1044453993 8:92370327-92370349 CAATCTTTCTAAATTGACATAGG + Intergenic
1047032646 8:120899414-120899436 CAATCTCACTAACTTGTTATTGG - Intergenic
1048535698 8:135292113-135292135 TCATCTCCCCAAATTCACATGGG - Intergenic
1048592043 8:135829404-135829426 CAATCTCGGCACATTTATATGGG + Intergenic
1048981642 8:139705719-139705741 CACTCTCCCCAGATTCATTTTGG + Intergenic
1050295490 9:4200585-4200607 CAATCTGCCAAAATTGAAACAGG + Intronic
1050753090 9:8964270-8964292 CAATCTCCCAAGATTGAATTAGG - Intronic
1053627068 9:39885125-39885147 CAATCTTTCCAAATTGTAATCGG + Intergenic
1053778923 9:41580897-41580919 CAATCTTTCCAAATTGTAATCGG - Intergenic
1054166883 9:61791137-61791159 CAATCTTTCCAAATTGTAATCGG - Intergenic
1054216819 9:62365578-62365600 CAATCTTTCCAAATTGTAATCGG - Intergenic
1054670663 9:67789762-67789784 CAATCTTTCCAAATTGTAATCGG + Intergenic
1055362912 9:75513485-75513507 AAATCTCTACAAATTGATATGGG - Intergenic
1055490893 9:76804470-76804492 CACTCTTCCCAAAGTGATATGGG - Intronic
1055990257 9:82098198-82098220 CAATCTCCCCAGATTGAATCAGG - Intergenic
1057591809 9:96379507-96379529 CAATCTGCCCAAAATGAAAGAGG + Intronic
1058954335 9:109931586-109931608 CAATCCCACCAAGTTGATAATGG + Intronic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1186225623 X:7396106-7396128 CCATCTCCCCAAAGAGATCTTGG + Intergenic
1187112325 X:16314420-16314442 GAATCTCCCCAAATTGCTCCTGG - Intergenic
1188091662 X:25972099-25972121 CAACCTCCCAAGATTGATACAGG + Intergenic
1188172791 X:26948663-26948685 CAACCTCCCAAGATTGAAATAGG - Intergenic
1190506492 X:51131584-51131606 CAATCTCCCAAGATAGATCTAGG - Intergenic
1193715304 X:84929265-84929287 CAATCTCATTAAACTGATATTGG + Intergenic
1193882587 X:86942415-86942437 GAATTTCCCCAAATTAATGTTGG + Intergenic
1194099917 X:89691008-89691030 CAATCTCCCAAAATTGAACAAGG - Intergenic
1194726696 X:97406719-97406741 CAATTTCCCCCTGTTGATATAGG + Intronic
1194759784 X:97782042-97782064 CAATCTCTCAAAATTGATTAAGG - Intergenic
1195122642 X:101771347-101771369 CAATCTACCAAAATTGAAACAGG - Intergenic
1195312952 X:103651707-103651729 CAATCTTCACTAATTGCTATTGG - Intergenic
1195634796 X:107101912-107101934 CAATCTCCTCAATGTAATATAGG - Intronic
1196568764 X:117240861-117240883 AACTCTCTCCAAACTGATATAGG + Intergenic
1198952266 X:142084626-142084648 AAATCTCCCCAAACTGTTCTTGG - Intergenic
1200452920 Y:3352366-3352388 CAATCTCCCAAAATTGAACAAGG - Intergenic
1201760941 Y:17537372-17537394 CAAGCTCCCAACATTGAGATGGG + Intergenic
1201840611 Y:18368618-18368640 CAAGCTCCCAACATTGAGATGGG - Intergenic
1202060258 Y:20879689-20879711 CAAACTCTCCAAATTGAGAATGG - Intergenic