ID: 1113887702

View in Genome Browser
Species Human (GRCh38)
Location 13:113669773-113669795
Sequence TGATGGTCATCACCAGACAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 102}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113887702_1113887715 25 Left 1113887702 13:113669773-113669795 CCTCTGTCTGGTGATGACCATCA 0: 1
1: 0
2: 2
3: 5
4: 102
Right 1113887715 13:113669821-113669843 GCTGGGCCAGAGGGCACGAGGGG 0: 1
1: 0
2: 2
3: 36
4: 330
1113887702_1113887714 24 Left 1113887702 13:113669773-113669795 CCTCTGTCTGGTGATGACCATCA 0: 1
1: 0
2: 2
3: 5
4: 102
Right 1113887714 13:113669820-113669842 GGCTGGGCCAGAGGGCACGAGGG 0: 1
1: 0
2: 3
3: 33
4: 358
1113887702_1113887711 15 Left 1113887702 13:113669773-113669795 CCTCTGTCTGGTGATGACCATCA 0: 1
1: 0
2: 2
3: 5
4: 102
Right 1113887711 13:113669811-113669833 TCAGGTAAGGGCTGGGCCAGAGG 0: 1
1: 0
2: 1
3: 41
4: 359
1113887702_1113887707 2 Left 1113887702 13:113669773-113669795 CCTCTGTCTGGTGATGACCATCA 0: 1
1: 0
2: 2
3: 5
4: 102
Right 1113887707 13:113669798-113669820 AACGGAGGTGACATCAGGTAAGG 0: 1
1: 0
2: 0
3: 10
4: 103
1113887702_1113887710 8 Left 1113887702 13:113669773-113669795 CCTCTGTCTGGTGATGACCATCA 0: 1
1: 0
2: 2
3: 5
4: 102
Right 1113887710 13:113669804-113669826 GGTGACATCAGGTAAGGGCTGGG 0: 1
1: 0
2: 2
3: 14
4: 173
1113887702_1113887716 26 Left 1113887702 13:113669773-113669795 CCTCTGTCTGGTGATGACCATCA 0: 1
1: 0
2: 2
3: 5
4: 102
Right 1113887716 13:113669822-113669844 CTGGGCCAGAGGGCACGAGGGGG 0: 1
1: 0
2: 1
3: 31
4: 395
1113887702_1113887713 23 Left 1113887702 13:113669773-113669795 CCTCTGTCTGGTGATGACCATCA 0: 1
1: 0
2: 2
3: 5
4: 102
Right 1113887713 13:113669819-113669841 GGGCTGGGCCAGAGGGCACGAGG 0: 1
1: 0
2: 4
3: 47
4: 552
1113887702_1113887709 7 Left 1113887702 13:113669773-113669795 CCTCTGTCTGGTGATGACCATCA 0: 1
1: 0
2: 2
3: 5
4: 102
Right 1113887709 13:113669803-113669825 AGGTGACATCAGGTAAGGGCTGG 0: 1
1: 0
2: 2
3: 15
4: 193
1113887702_1113887708 3 Left 1113887702 13:113669773-113669795 CCTCTGTCTGGTGATGACCATCA 0: 1
1: 0
2: 2
3: 5
4: 102
Right 1113887708 13:113669799-113669821 ACGGAGGTGACATCAGGTAAGGG 0: 1
1: 0
2: 0
3: 7
4: 99
1113887702_1113887706 -3 Left 1113887702 13:113669773-113669795 CCTCTGTCTGGTGATGACCATCA 0: 1
1: 0
2: 2
3: 5
4: 102
Right 1113887706 13:113669793-113669815 TCATGAACGGAGGTGACATCAGG 0: 1
1: 0
2: 0
3: 5
4: 69
1113887702_1113887712 16 Left 1113887702 13:113669773-113669795 CCTCTGTCTGGTGATGACCATCA 0: 1
1: 0
2: 2
3: 5
4: 102
Right 1113887712 13:113669812-113669834 CAGGTAAGGGCTGGGCCAGAGGG 0: 1
1: 0
2: 4
3: 47
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113887702 Original CRISPR TGATGGTCATCACCAGACAG AGG (reversed) Exonic