ID: 1113891601

View in Genome Browser
Species Human (GRCh38)
Location 13:113738643-113738665
Sequence ACTGGGATCAGGGGGCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 281}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113891589_1113891601 17 Left 1113891589 13:113738603-113738625 CCTATGGCCCTGGACAGGTAAGC 0: 1
1: 0
2: 1
3: 11
4: 149
Right 1113891601 13:113738643-113738665 ACTGGGATCAGGGGGCTTGGAGG 0: 1
1: 0
2: 3
3: 18
4: 281
1113891590_1113891601 10 Left 1113891590 13:113738610-113738632 CCCTGGACAGGTAAGCAATCTCA 0: 1
1: 0
2: 1
3: 15
4: 131
Right 1113891601 13:113738643-113738665 ACTGGGATCAGGGGGCTTGGAGG 0: 1
1: 0
2: 3
3: 18
4: 281
1113891585_1113891601 30 Left 1113891585 13:113738590-113738612 CCTGCCTTGCATTCCTATGGCCC 0: 1
1: 0
2: 2
3: 20
4: 175
Right 1113891601 13:113738643-113738665 ACTGGGATCAGGGGGCTTGGAGG 0: 1
1: 0
2: 3
3: 18
4: 281
1113891587_1113891601 26 Left 1113891587 13:113738594-113738616 CCTTGCATTCCTATGGCCCTGGA 0: 1
1: 0
2: 2
3: 19
4: 193
Right 1113891601 13:113738643-113738665 ACTGGGATCAGGGGGCTTGGAGG 0: 1
1: 0
2: 3
3: 18
4: 281
1113891591_1113891601 9 Left 1113891591 13:113738611-113738633 CCTGGACAGGTAAGCAATCTCAT 0: 1
1: 0
2: 1
3: 3
4: 97
Right 1113891601 13:113738643-113738665 ACTGGGATCAGGGGGCTTGGAGG 0: 1
1: 0
2: 3
3: 18
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113891601 Original CRISPR ACTGGGATCAGGGGGCTTGG AGG Intergenic