ID: 1113892990

View in Genome Browser
Species Human (GRCh38)
Location 13:113746205-113746227
Sequence GCTCCCTGCTCAGGAACACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113892990_1113892996 29 Left 1113892990 13:113746205-113746227 CCTTGTGTTCCTGAGCAGGGAGC No data
Right 1113892996 13:113746257-113746279 GCAGCTGCTCTGCGTTCCCCTGG No data
1113892990_1113892992 -10 Left 1113892990 13:113746205-113746227 CCTTGTGTTCCTGAGCAGGGAGC No data
Right 1113892992 13:113746218-113746240 AGCAGGGAGCTGCCCAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113892990 Original CRISPR GCTCCCTGCTCAGGAACACA AGG (reversed) Intergenic
No off target data available for this crispr