ID: 1113893779

View in Genome Browser
Species Human (GRCh38)
Location 13:113750045-113750067
Sequence GCTGATGGTGGGACACCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113893770_1113893779 21 Left 1113893770 13:113750001-113750023 CCTTGCCTTTTTCTCTGTGTTGA No data
Right 1113893779 13:113750045-113750067 GCTGATGGTGGGACACCTGCTGG No data
1113893768_1113893779 23 Left 1113893768 13:113749999-113750021 CCCCTTGCCTTTTTCTCTGTGTT No data
Right 1113893779 13:113750045-113750067 GCTGATGGTGGGACACCTGCTGG No data
1113893769_1113893779 22 Left 1113893769 13:113750000-113750022 CCCTTGCCTTTTTCTCTGTGTTG No data
Right 1113893779 13:113750045-113750067 GCTGATGGTGGGACACCTGCTGG No data
1113893771_1113893779 16 Left 1113893771 13:113750006-113750028 CCTTTTTCTCTGTGTTGACATTC No data
Right 1113893779 13:113750045-113750067 GCTGATGGTGGGACACCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113893779 Original CRISPR GCTGATGGTGGGACACCTGC TGG Intergenic
No off target data available for this crispr