ID: 1113896326

View in Genome Browser
Species Human (GRCh38)
Location 13:113766542-113766564
Sequence CAGGGTGACCAGAGGGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 639
Summary {0: 1, 1: 0, 2: 6, 3: 69, 4: 563}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113896315_1113896326 10 Left 1113896315 13:113766509-113766531 CCCTCCATTGTCTGGGTTGGCCC 0: 1
1: 0
2: 0
3: 10
4: 180
Right 1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG 0: 1
1: 0
2: 6
3: 69
4: 563
1113896316_1113896326 9 Left 1113896316 13:113766510-113766532 CCTCCATTGTCTGGGTTGGCCCG 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG 0: 1
1: 0
2: 6
3: 69
4: 563
1113896321_1113896326 -10 Left 1113896321 13:113766529-113766551 CCCGATGTGGTCACAGGGTGACC 0: 1
1: 0
2: 1
3: 9
4: 98
Right 1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG 0: 1
1: 0
2: 6
3: 69
4: 563
1113896312_1113896326 17 Left 1113896312 13:113766502-113766524 CCAGGTGCCCTCCATTGTCTGGG 0: 1
1: 0
2: 0
3: 17
4: 183
Right 1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG 0: 1
1: 0
2: 6
3: 69
4: 563
1113896317_1113896326 6 Left 1113896317 13:113766513-113766535 CCATTGTCTGGGTTGGCCCGATG 0: 1
1: 0
2: 0
3: 6
4: 53
Right 1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG 0: 1
1: 0
2: 6
3: 69
4: 563

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113896326 Original CRISPR CAGGGTGACCAGAGGGCAGG AGG Intronic
900018698 1:171917-171939 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
900048956 1:530512-530534 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
900071187 1:772336-772358 TAGGCTGGCCAGAGGGGAGGTGG + Intergenic
900607665 1:3531076-3531098 GCCGGTGACCAGAGGCCAGGTGG - Intronic
900629019 1:3624167-3624189 CAGGGTTACCTTCGGGCAGGAGG - Intergenic
900644330 1:3702241-3702263 CAGGCAGGCCAGGGGGCAGGCGG + Intronic
900650727 1:3728877-3728899 GAGGATCACCTGAGGGCAGGAGG + Intronic
900670872 1:3853998-3854020 TAGGTTGCCCAGAGTGCAGGTGG - Intronic
900821490 1:4892825-4892847 CAGGGTGAGAAGAGTGCAGAAGG - Intergenic
900880344 1:5377049-5377071 CAGTGAGACCCGAGGGCAGCTGG - Intergenic
900970854 1:5991913-5991935 CAGAGAGGCCAGGGGGCAGGGGG + Intronic
901069539 1:6510215-6510237 CAGGAGAGCCAGAGGGCAGGGGG - Intronic
901757102 1:11448084-11448106 CAGGGCGGCCTGAGGGCTGGGGG + Intergenic
901784251 1:11614124-11614146 CAGCGTCAGGAGAGGGCAGGGGG - Intergenic
901810322 1:11763761-11763783 AAGGGTGACCAGTTGGGAGGTGG + Intronic
902111808 1:14085436-14085458 CAGGGTTGCCAGTGGTCAGGGGG - Intergenic
902142398 1:14367577-14367599 AAGGGTGACCAGTAGGCTGGAGG - Intergenic
902408181 1:16197949-16197971 AAGGGTGACCAGGGGGCAGGGGG - Intronic
902548664 1:17206311-17206333 GAGGATCACCAGAGGCCAGGTGG - Intronic
903330042 1:22592659-22592681 CGGGGTGAGCAGAGGGGAGGAGG + Intronic
903849505 1:26297497-26297519 CAGGGTGAGCACAGGGCCTGTGG + Intronic
904504496 1:30939589-30939611 GAGAGTAACCAAAGGGCAGGTGG - Intronic
904597529 1:31656286-31656308 CAGGAAGGCCAGTGGGCAGGGGG - Intronic
906148143 1:43572068-43572090 GAAGGTGAGCAGAGGGCCGGAGG - Intronic
906281370 1:44556454-44556476 CAGGTTTACCAGAGGACAGCAGG - Intronic
906484820 1:46226160-46226182 CAGGGTGGAAAGTGGGCAGGAGG + Intergenic
906543288 1:46604339-46604361 CAGGGCCGCCTGAGGGCAGGGGG + Intronic
907197313 1:52697515-52697537 AAGGGTGTCAGGAGGGCAGGAGG - Intronic
907525151 1:55049696-55049718 CATGGCCAGCAGAGGGCAGGTGG - Intronic
908768948 1:67578554-67578576 AAGGGTAACCTGAGGGCTGGTGG + Intergenic
909329651 1:74396167-74396189 CAGGGAGATCAGAGGGCAGCAGG + Intronic
909745742 1:79095185-79095207 CAGGGTGGCCAAAGGTCACGTGG + Intergenic
910118635 1:83760274-83760296 CAGGGTGAACAGCTTGCAGGAGG + Intergenic
911642448 1:100303556-100303578 CAGGTTGACCACAGTGGAGGAGG + Intergenic
912173828 1:107134092-107134114 CATTGTGACCAGAAAGCAGGTGG - Intergenic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
912679892 1:111722328-111722350 CAGGGTGGCCGGAGGGCAGGAGG + Exonic
912861775 1:113219841-113219863 CAGAGTGACCACAGGCCTGGTGG + Intergenic
913490357 1:119374149-119374171 CATGGGGAAGAGAGGGCAGGGGG - Intronic
914390271 1:147215001-147215023 CAGGATGATCAGAAGGCAGAAGG + Intronic
915444431 1:155966788-155966810 CAGGGAGGGCAGAGGGCTGGGGG - Intronic
915506665 1:156361345-156361367 CAGGATCACCAGAGCCCAGGAGG + Intronic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
916052873 1:161048463-161048485 GAGGGAGACCAGAGGGCTGGAGG - Exonic
916723325 1:167501745-167501767 CAAGGAGACCAGAAGGCAGGAGG + Intronic
919611799 1:199754368-199754390 CAAGGTGACCAGTGGAAAGGGGG - Intergenic
920292048 1:204929982-204930004 CATGGGGATCAGAGGGCAGGAGG + Intronic
920496872 1:206461179-206461201 CTGGGTGTGCAGAGGGCTGGAGG - Exonic
921266604 1:213425875-213425897 GATGGTGACCAGCGGGAAGGTGG + Intergenic
922106548 1:222517785-222517807 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
922223482 1:223626430-223626452 CAGGGCAGCCAGAGGGCAGCTGG + Intronic
922471592 1:225880423-225880445 CAGGCTGAGGAGAAGGCAGGGGG + Intronic
922717575 1:227885292-227885314 CAGGTGCAGCAGAGGGCAGGCGG + Intergenic
922778673 1:228232078-228232100 CAGGGTGGCCAGATGGTGGGGGG - Intronic
922961154 1:229646752-229646774 CAGGGTTTTTAGAGGGCAGGAGG - Intronic
923238506 1:232058180-232058202 CAGAGAGGGCAGAGGGCAGGAGG - Intergenic
923482233 1:234396456-234396478 CAGGGTGAAGAGAGGGACGGAGG - Intronic
924348732 1:243095351-243095373 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
924536161 1:244937487-244937509 TAGGGTGACCAGTGGGAAGCTGG - Intergenic
1063360538 10:5452504-5452526 CAGGGAGATCAGACGGCAGGAGG + Exonic
1065386937 10:25143256-25143278 TTGGGTGACCACAGGACAGGTGG + Intergenic
1065804734 10:29384073-29384095 CAGGGTGATCAGAGAGCAGGAGG + Intergenic
1065944399 10:30593699-30593721 CAGAGTGACCAAGGAGCAGGAGG - Intergenic
1066301542 10:34101684-34101706 CAGGGAGACCAGTGTGCTGGAGG - Intergenic
1066727628 10:38409552-38409574 AAGGCTGGCCAGAGGGGAGGTGG - Intergenic
1067081209 10:43213436-43213458 CAGGGTGAGAAGAGGGGAGGGGG + Intronic
1067166740 10:43871271-43871293 AAGGCTGACCGGAGAGCAGGAGG + Intergenic
1067168719 10:43886166-43886188 GAGTGTGGGCAGAGGGCAGGTGG + Intergenic
1067274050 10:44818982-44819004 CAGGGTGAGCAGGGGTCAGAAGG + Intergenic
1067546015 10:47193172-47193194 CAGGGGAAACAGAGGGCAGGAGG + Intergenic
1069562716 10:69442030-69442052 CAGGGAGAGCAGGGGACAGGAGG + Intergenic
1069719222 10:70539254-70539276 AGGGGTGCCTAGAGGGCAGGGGG - Intronic
1069769017 10:70886036-70886058 GTGGGTGACCAAAGGGCAGCAGG + Intronic
1070159652 10:73858531-73858553 GAGGGTGGGCAGAGGGAAGGGGG - Intronic
1070490321 10:76969899-76969921 CAGGGTGAGGAGAGGGCGAGGGG + Intronic
1070950647 10:80428320-80428342 CAGTGTCAGCAGAGGCCAGGAGG + Intronic
1072451582 10:95543200-95543222 CAGGGTGCCATGAGGGCATGTGG - Intronic
1072615416 10:97046365-97046387 CAGCCTGACCAGAGGGCAATGGG + Intronic
1072711984 10:97721839-97721861 GAGGGTGACCTGAGCCCAGGAGG - Intergenic
1072758730 10:98038539-98038561 CAGGGAGGCCAGAGGTCAGAGGG + Intergenic
1073053941 10:100687202-100687224 CCAGGGGACCAGAGGGCAGTTGG - Intergenic
1073084573 10:100879966-100879988 CAGGGTGGCTACATGGCAGGTGG - Intergenic
1075030560 10:119021915-119021937 CTTAGTGACCAGAAGGCAGGTGG - Intergenic
1075260463 10:120959016-120959038 CTGGGTGAACAGAAGACAGGTGG - Intergenic
1075518199 10:123126484-123126506 AAGGCTGGACAGAGGGCAGGAGG - Intergenic
1075626124 10:123965633-123965655 GAGGGTGCCCAGGGGGCATGTGG - Intergenic
1076474784 10:130744309-130744331 CAGGGAGGGCAGAGGGCAGGAGG - Intergenic
1076489317 10:130846184-130846206 CAAGGTCACCAGGGTGCAGGAGG + Intergenic
1076608867 10:131707915-131707937 CAGGGGGATCAGTGGGCAGAGGG + Intergenic
1076615437 10:131751526-131751548 CCGGGAGGCCAGAGGTCAGGTGG - Intergenic
1076783475 10:132737228-132737250 GTGTGTGTCCAGAGGGCAGGTGG + Intronic
1076840671 10:133043756-133043778 CAAGGAGACCTCAGGGCAGGTGG - Intergenic
1076853560 10:133104607-133104629 AAGGGGGCCCAGAGGGCAGGGGG - Intronic
1076975300 11:167113-167135 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
1077030370 11:462789-462811 CAGGGTGTCCAGAAGGCTGTGGG + Intronic
1077353952 11:2106109-2106131 CTGAGTGACCAGAGTGCAAGAGG - Intergenic
1077378481 11:2216452-2216474 CAGGGTCTCCTGAGGTCAGGAGG + Intergenic
1080064001 11:27988404-27988426 AGAGGTGACCAGAGGCCAGGTGG + Intergenic
1081623983 11:44635690-44635712 CAGGGAGATCAGAAGGCAGCAGG + Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083152206 11:60798848-60798870 AAGGGAGGCCAGAGGGCATGGGG - Intronic
1083365810 11:62140876-62140898 CAGGGTCAGAAGTGGGCAGGCGG - Intronic
1083595483 11:63916778-63916800 CAGGGCGCCCCGAGGACAGGGGG - Exonic
1084045094 11:66563792-66563814 CAGGGTGAGCAGAGGGCACTGGG - Exonic
1084045355 11:66564852-66564874 CAGGGTGAGGTGAGGTCAGGTGG - Intronic
1084568351 11:69944295-69944317 CAGGGTGCGGACAGGGCAGGAGG + Intergenic
1084719224 11:70893377-70893399 GGGGGTGACCACAGGGGAGGGGG + Intronic
1084933372 11:72574257-72574279 CATGGTGACCAGTGGGTCGGGGG - Intergenic
1085520475 11:77136215-77136237 CACGGCGGCCAGAGGGCAGTAGG - Intronic
1085527941 11:77174923-77174945 CTGAGTGCACAGAGGGCAGGAGG + Intronic
1085532639 11:77201052-77201074 CCGTGTGACCAGAGCACAGGGGG + Intronic
1085555866 11:77421139-77421161 CAGGGTGAGATGAGGGGAGGAGG - Intronic
1085757680 11:79215316-79215338 AAGGCTGTCCAGAAGGCAGGTGG - Intronic
1085862858 11:80255148-80255170 CAGGTTGATCAGAGGAAAGGTGG + Intergenic
1088325232 11:108593874-108593896 GAGGGTGACCGGAGGGGACGAGG - Intergenic
1089176439 11:116552180-116552202 CAGGGTGAAGAGGGTGCAGGTGG - Intergenic
1089356456 11:117857077-117857099 CAGGGACATGAGAGGGCAGGAGG + Intronic
1090718499 11:129451753-129451775 CTGGCTGCCCAGAGGTCAGGAGG - Exonic
1090913996 11:131146444-131146466 GAGGGGGACATGAGGGCAGGAGG - Intergenic
1090941610 11:131392607-131392629 CAGGTTGAAGAGAGGGCAGGAGG + Intronic
1091571635 12:1691496-1691518 GAAGGTGAGCAGAGGGCAGCAGG - Intronic
1091673150 12:2467353-2467375 CAGAGTGACCTGGTGGCAGGTGG + Intronic
1091773520 12:3169242-3169264 CAGGTTGACCTCAGGGCTGGGGG + Intronic
1092071110 12:5632020-5632042 GGGGATGACCAGAGGACAGGAGG + Intronic
1092111285 12:5966594-5966616 CACAGTGGCCAGAGGGGAGGGGG - Intronic
1093027224 12:14255953-14255975 AAGCTTGACCAGAGGGTAGGAGG + Intergenic
1094492010 12:30966657-30966679 CAGAGGGACCAGAGGCCAAGGGG + Intronic
1095130964 12:38541763-38541785 CAGAGGGGCCAGAGGGGAGGTGG + Intergenic
1096182299 12:49557603-49557625 CAGGGTGCCATGAGGGGAGGAGG - Exonic
1096257491 12:50072334-50072356 GAAGGTGACCCGAGGGGAGGAGG - Intronic
1096266779 12:50129873-50129895 GAGGGTGAGCTGAGGGCTGGAGG - Exonic
1096537184 12:52282609-52282631 GAGAGTGACCATAGGGCAGGAGG + Intronic
1096649175 12:53053494-53053516 CATGGTGTCCAGAGGTCTGGTGG + Intronic
1096689980 12:53314554-53314576 CAGGGGCACCATAGGACAGGAGG + Intronic
1097156637 12:57016613-57016635 CAGGGTGGCTGGAGGGGAGGCGG + Intronic
1098722172 12:73914031-73914053 CAGGGTGACTAGATGGAAGCAGG + Intergenic
1098833876 12:75397039-75397061 CAGGGAGACTAGAGAGCATGGGG - Intronic
1098844311 12:75517174-75517196 CACGGTAACCAGAGGGTAGAGGG + Intergenic
1099245255 12:80186436-80186458 CAGGGAGACCAAAGAGCAGAGGG - Intergenic
1102587557 12:113933653-113933675 CAGGGGGACCCGCGGGCAGGGGG + Intronic
1103188733 12:118982324-118982346 CACAGAGTCCAGAGGGCAGGTGG + Intronic
1103362310 12:120361560-120361582 CATGGGAACCCGAGGGCAGGGGG + Intronic
1103937122 12:124482662-124482684 CTGGGTCACCTGAGGGCAGATGG + Intronic
1104312222 12:127663701-127663723 GAGGGAGACCAAAGGACAGGTGG - Intergenic
1104391897 12:128397851-128397873 GAGGCTGAGCAGAGGGGAGGTGG - Intronic
1104509173 12:129360583-129360605 CTGGGTGATCAGATGGAAGGTGG - Intronic
1104648603 12:130514643-130514665 CAGGCTGACGACAGGGCTGGTGG - Intronic
1104877284 12:132044328-132044350 CAGGGGGGCAAGAGGGCAGGAGG - Intronic
1104973564 12:132542132-132542154 CAGGATGACCAGATGGCACAGGG + Intronic
1105370293 13:19796168-19796190 CAGGGTGACCAGACCCCTGGGGG + Intergenic
1105425977 13:20295572-20295594 GAGGGTGACAAGGGAGCAGGAGG + Intergenic
1105801679 13:23909157-23909179 CAGGATGACCTGAGCTCAGGGGG + Intergenic
1105948671 13:25210713-25210735 CTGTGTGACCCTAGGGCAGGAGG + Intergenic
1106308229 13:28532295-28532317 CAGGGTGGACAGCGGGCGGGTGG - Intergenic
1107634756 13:42381001-42381023 CAGGGTGCACAGAGGGGAGGGGG + Intergenic
1107829632 13:44362877-44362899 CAGAGTGCCCAGAGAACAGGAGG + Intergenic
1108376730 13:49820950-49820972 CAGGGTGACCTGAGGCCATGGGG - Intergenic
1109264623 13:60183096-60183118 AAGGGTCACCTGAGGCCAGGAGG + Intergenic
1109458846 13:62627479-62627501 CTGGGTGCCGAGAGGGCCGGGGG - Intergenic
1109546600 13:63841905-63841927 CAGAGAGACAAGATGGCAGGTGG + Intergenic
1112004172 13:95240156-95240178 GAGGGTCACAAGAGGGGAGGAGG + Intronic
1112691698 13:101903616-101903638 CAGGGTGACTATAGGGAAGGAGG + Intronic
1113138147 13:107116839-107116861 CAGGGTGGGCAGAAGGCAGAGGG + Intergenic
1113388456 13:109873067-109873089 CAGGGCGCACTGAGGGCAGGAGG + Intergenic
1113626320 13:111850620-111850642 CACGGGCACCACAGGGCAGGAGG - Intergenic
1113811393 13:113144504-113144526 CAGGGGCATCAGCGGGCAGGAGG + Intronic
1113826274 13:113256531-113256553 CAGGGTGAGCGAAGGACAGGTGG - Intronic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1113922544 13:113921670-113921692 CAGGGTGGGCGAAGGGCAGGGGG - Intergenic
1113929044 13:113956843-113956865 CAGGGCGAGAGGAGGGCAGGTGG + Intergenic
1114073139 14:19131613-19131635 CAGTGTGCCCAGTGGGCATGGGG - Intergenic
1114089127 14:19268370-19268392 CAGTGTGCCCAGTGGGCATGGGG + Intergenic
1114715016 14:24815879-24815901 CAGGCTCACCAGAGTGGAGGTGG + Intronic
1117049594 14:51847009-51847031 CATGGTAACCAGAGGGGGGGAGG + Intronic
1117095787 14:52296044-52296066 CTGGGTGACCAGATGGCAAAAGG - Intergenic
1118225027 14:63890571-63890593 GAGGGAGACAGGAGGGCAGGTGG + Intronic
1118284151 14:64455816-64455838 CAGTGTGAGCTGAGGGCAGCAGG - Intronic
1118307037 14:64663396-64663418 CAGGAAGGCAAGAGGGCAGGTGG + Intergenic
1118735134 14:68695697-68695719 CAGGGTGACCAGAGGCTTGTGGG - Intronic
1120495353 14:85227640-85227662 CAGGGTGTCCACAGGACATGTGG + Intergenic
1120733456 14:88027891-88027913 CAGGGTGGCCCCAGGGAAGGAGG + Intergenic
1121050155 14:90815190-90815212 CACCGTGGCCAGAGGGCAGAGGG - Intronic
1121302192 14:92880725-92880747 CAATGTGACCAGGAGGCAGGTGG - Intergenic
1121321695 14:92995266-92995288 GTGGGTGAGCAGAGGGCAGGGGG - Intronic
1121333071 14:93060044-93060066 GCAGGAGACCAGAGGGCAGGAGG + Intronic
1122886919 14:104714323-104714345 CAGGGTGGGCTGAGGGCCGGGGG - Exonic
1122983680 14:105202687-105202709 CAAGGTGAACAGACGGCTGGAGG - Intergenic
1124504617 15:30262056-30262078 CAGGGTGACCCGAGGCCCTGGGG + Intergenic
1124700750 15:31909886-31909908 CTGGGTACCCAGAAGGCAGGGGG + Intergenic
1124738935 15:32276579-32276601 CAGGGTGACCCGAGGCCCTGGGG - Intergenic
1125327863 15:38555016-38555038 CAAGGTGCCCAGAGGGCAACAGG - Intronic
1125744435 15:41989067-41989089 CAGGGAGACCACAGGGTAAGGGG - Intronic
1125813356 15:42562075-42562097 GAGGGTGACCTGAGCCCAGGAGG + Intronic
1125841834 15:42809137-42809159 GAGTGAGAACAGAGGGCAGGTGG - Intronic
1126317437 15:47385489-47385511 CAGGGAAAGCAGAGGCCAGGTGG - Intronic
1126915070 15:53457289-53457311 CTGGGGGAACAGGGGGCAGGTGG - Intergenic
1127898317 15:63321911-63321933 GAGGGAGACAGGAGGGCAGGAGG - Exonic
1127994343 15:64144402-64144424 CAGGGAGTCCAGAGCTCAGGAGG - Intronic
1128242546 15:66110843-66110865 CAAGGTGCCAAGAGGGCATGGGG - Intronic
1128314740 15:66653499-66653521 CAGGGTGATCAGAGGGGGAGGGG + Intronic
1129203282 15:74019052-74019074 CAGTCTTACCAGAGGGCTGGGGG + Intronic
1129226410 15:74172957-74172979 CTGGGTGCCCAGTGGGCAGTGGG + Intergenic
1129333192 15:74838220-74838242 CAGGGTGGCCAGAGGCCCTGTGG + Intronic
1129414026 15:75364800-75364822 CAGTGTGACAAGAGTGCATGTGG + Intronic
1129737610 15:77974890-77974912 CTGGGTGGCCTTAGGGCAGGTGG - Intergenic
1129785139 15:78304760-78304782 CAGGATAACCAGTGGGCAGAGGG + Intergenic
1129848463 15:78778729-78778751 CTGGGTGGCCTCAGGGCAGGTGG + Intronic
1129889943 15:79065394-79065416 CAGGGATGCCAGTGGGCAGGTGG + Intronic
1130332171 15:82930983-82931005 CGGGGTGTGCACAGGGCAGGAGG - Intronic
1131272770 15:90957072-90957094 CAGGGTGGCCAGAATGGAGGCGG - Intronic
1131857722 15:96616578-96616600 CAGGGAGACCAAAGGCCGGGAGG - Intergenic
1132478557 16:154279-154301 CAGGGTGACCAGCAGGCAGTGGG - Exonic
1132480735 16:165035-165057 CAGGGTGACCAGCAGGCAGTGGG - Intronic
1132506900 16:314837-314859 CAGAGGGACAAGAGGACAGGTGG - Intronic
1132656881 16:1045127-1045149 GAGGCTGACCAGAGCCCAGGGGG - Intergenic
1132672728 16:1108317-1108339 CAGAGTGGCCAGTGGGGAGGTGG + Intergenic
1133317329 16:4892799-4892821 CAGGGTGAGCTGATGCCAGGGGG - Intronic
1134650509 16:15904784-15904806 CAGAGTGACCAAAGAGCAGGTGG - Intergenic
1135044046 16:19140183-19140205 CAGGATGATCAGAGAGCTGGGGG - Intronic
1135399530 16:22156599-22156621 CATGGTGAACAGTGAGCAGGCGG + Exonic
1136183374 16:28570253-28570275 CAGTGTGTCCAGAAGGTAGGAGG + Intronic
1136399508 16:30010046-30010068 CAGGGGGACCAGATGGGCGGGGG + Exonic
1136687622 16:32004320-32004342 CAGGGTGACCCCAGGTCTGGAGG + Intergenic
1136788231 16:32947871-32947893 CAGGGTGACCCCAGGTCTGGAGG + Intergenic
1136881552 16:33905918-33905940 CAGGGTGACCCCAGGTCTGGAGG - Intergenic
1137557668 16:49482957-49482979 CAGGGTGGCCAGGGGGCACCTGG + Intergenic
1137935369 16:52630153-52630175 GAGAGTGAACAGAGGGGAGGAGG + Intergenic
1138350803 16:56345342-56345364 CAGGGAGAACAGAGGGCTTGAGG - Exonic
1138352145 16:56351822-56351844 GAGGGTGACCAGGAGGAAGGGGG - Intronic
1138655780 16:58490475-58490497 CAGGGTGCCCAGAGGGCATGAGG - Intronic
1139265569 16:65635463-65635485 CAGGGGGAACACAGGGTAGGTGG - Intergenic
1140408277 16:74725343-74725365 CAGACAGACCACAGGGCAGGTGG + Intronic
1141171472 16:81694345-81694367 AAGGATGAGCAGAGGACAGGGGG + Intronic
1141540079 16:84713392-84713414 CAGGGTGACAAGTGTGAAGGAGG - Intronic
1141557197 16:84844022-84844044 CTGGGTGTGCAGAGGGCAGGAGG + Intronic
1141815157 16:86404708-86404730 CAGGAAGACCTGAGGGAAGGCGG - Intergenic
1141923804 16:87153746-87153768 CTGGGGGACCAGGGGTCAGGAGG + Intronic
1142104376 16:88294481-88294503 CTGGGAGCCCAGAGGGCAGGAGG - Intergenic
1142359495 16:89619573-89619595 CAGGGGGACCAGGGGGCTGCAGG - Intronic
1142425344 16:89999594-89999616 CAGGGTGGGCAGAGCGTAGGTGG + Intergenic
1142444960 16:90130546-90130568 AAGGCTGGCCAGAGGGGAGGTGG - Intergenic
1203090462 16_KI270728v1_random:1209528-1209550 CAGGGTGACCCCAGGTCTGGAGG + Intergenic
1142462550 17:104920-104942 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG + Intronic
1142730535 17:1852525-1852547 CAGGAAGGCCAGAGGGCAGAGGG + Intronic
1143012008 17:3871124-3871146 CAGCGAGACCAGGGGGAAGGTGG + Intronic
1143166518 17:4899773-4899795 CAGGGTGTCCAGGGAGCTGGGGG - Exonic
1143586261 17:7852123-7852145 CGGGGTGGCCACAGGTCAGGTGG - Intronic
1144447684 17:15346077-15346099 CAGAGTGGCCACAGAGCAGGTGG + Intergenic
1144580693 17:16457441-16457463 CAGCAAGACCAGAGGGCAGGAGG + Intronic
1144738630 17:17568895-17568917 CAGGGTGGCCAGACGGTAGGTGG - Intronic
1145031411 17:19507646-19507668 GAGGAAGCCCAGAGGGCAGGGGG - Intronic
1145840431 17:27989697-27989719 CAGGGAGAACAGAAGGCAAGTGG - Intergenic
1145992956 17:29090178-29090200 CACAGTGACCAGAAGGCAAGGGG + Intronic
1146400602 17:32497580-32497602 CAGGGACAACAGAGGGCAGGAGG - Intronic
1146734900 17:35230356-35230378 CAGGATGAATAGAGGGAAGGGGG + Intergenic
1146907884 17:36629690-36629712 CAGAGGGACCAGAGGGCAGCTGG + Intergenic
1147148606 17:38499989-38500011 CAGGGTGACCCCAGGTCCGGAGG + Intronic
1147427447 17:40352659-40352681 CAGGGAGACGAGTGGACAGGTGG - Intronic
1147442977 17:40458658-40458680 CAGGGAGACCAGATGGCTGCAGG - Intergenic
1147544968 17:41394062-41394084 CAGGGTGTGCAGGGGGCAGGAGG + Exonic
1148678057 17:49456533-49456555 CAGCGTGACCAGAGTGGAGGGGG - Intronic
1148764507 17:50029265-50029287 GGAGGTGACCAGAGGGCAGAGGG - Intergenic
1148857270 17:50585620-50585642 CAGTGTGCCCAGTGGGCAGGAGG + Intronic
1149257288 17:54841096-54841118 GAGGATGACCTGAGGCCAGGAGG - Intergenic
1149719487 17:58828686-58828708 GAGGATCACCAGAGGTCAGGAGG - Intronic
1150077628 17:62206735-62206757 CAGGGGCACCAAAGGGCAGCTGG - Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150655705 17:67038047-67038069 CACGGTGACCAGCGTGCAGAGGG - Intergenic
1151338731 17:73456161-73456183 CAGGATGACCACAGGGAAGGAGG + Intronic
1151508273 17:74543275-74543297 CAGGGTGACCTGGGGGAATGGGG + Intronic
1151546750 17:74797940-74797962 CAGAATGACCAGGGGGCAGCGGG - Intronic
1151701231 17:75743638-75743660 CAGGGTCACAGGAGAGCAGGAGG + Intronic
1152442923 17:80320175-80320197 GTGGGTGACTAGAGGGGAGGAGG - Intronic
1153479250 18:5530607-5530629 CAGCGTGTACAGAGGCCAGGAGG - Intronic
1153953458 18:10076329-10076351 CATGGTGACCAGCGGCCATGGGG - Intergenic
1154308951 18:13253030-13253052 CAGGGTGCCCAGAGTGAAGCAGG - Intronic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156284657 18:35679957-35679979 CATGGTGAACAGATGGGAGGGGG - Intronic
1157190915 18:45580945-45580967 CAGGCTGAGCAGGAGGCAGGAGG + Intronic
1157300473 18:46475233-46475255 CTGGGTCACCAAAAGGCAGGAGG + Intergenic
1157566273 18:48681020-48681042 CAGGCTGACCCGCCGGCAGGCGG + Intronic
1157690009 18:49673799-49673821 CAGGGTGACCAGAGGACCAGGGG + Intergenic
1158397124 18:57088214-57088236 CAGGGAGACCACAGGGCTGGGGG + Intergenic
1158962975 18:62601666-62601688 CAGGGCGAGGAGAGGGCAGCTGG + Intergenic
1160141272 18:76325349-76325371 CATGGAGCCCAGAGTGCAGGAGG - Intergenic
1160144449 18:76352151-76352173 CAGGATGTCCAGAGAGCTGGGGG + Intergenic
1160145442 18:76360040-76360062 CAGGGTGCACAGAGTGCAGGAGG - Exonic
1160342627 18:78102490-78102512 CAGGATGACCTGAAGGCGGGGGG + Intergenic
1160652257 19:237296-237318 TAGGCTGGCCAGAGGGGAGGTGG + Intergenic
1160913197 19:1484119-1484141 CGTGGTGACCTGAGGGCAGAGGG + Exonic
1160913930 19:1487853-1487875 CAGGGGGTCCTGGGGGCAGGTGG + Exonic
1161026427 19:2039350-2039372 GAAGGTGAGCAGAGGGTAGGTGG - Exonic
1161231336 19:3176531-3176553 CTGGGGGGACAGAGGGCAGGTGG + Intronic
1161406415 19:4093896-4093918 CAGGCTGGGCTGAGGGCAGGAGG + Intronic
1161852843 19:6746548-6746570 GAGGTTGACCAGAGGTAAGGTGG + Exonic
1162743138 19:12784202-12784224 CAGGGTGACCAGACAGGGGGCGG + Intronic
1162783118 19:13017469-13017491 CAGGCCGATCTGAGGGCAGGTGG + Intronic
1162791800 19:13066864-13066886 CAGGGCAGCCAGAGGGCCGGGGG - Intronic
1162801379 19:13112658-13112680 CAGGGAGACCGGGGGACAGGTGG - Intronic
1162926276 19:13931934-13931956 GAGGGTGACCGGAGGGGTGGAGG - Intronic
1163112497 19:15170092-15170114 CAGAGTGCCCAGAGGCCAAGCGG - Exonic
1163437047 19:17302187-17302209 CAGGGTGTCCACAGGGAAGGTGG + Intronic
1163518044 19:17776595-17776617 CAGGGTGACAAGAAGGCTGAAGG + Intronic
1164152641 19:22568524-22568546 CAAGGTGCTCAGTGGGCAGGAGG - Intergenic
1164569856 19:29366027-29366049 CTGTGTCAGCAGAGGGCAGGGGG - Intergenic
1164771732 19:30815030-30815052 CAGTGTGACTAGAGAGGAGGAGG + Intergenic
1165061378 19:33206833-33206855 CAGGGTGACCTGAGGGCCCATGG + Intronic
1165198843 19:34129101-34129123 CAGGGTAACCACAGGACAAGGGG + Intergenic
1165241518 19:34472156-34472178 CAGGGTGAGGACAGGGCACGCGG - Intergenic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1165979445 19:39707247-39707269 CAGGATGACCAAAGTGCAGTCGG - Exonic
1165993397 19:39828289-39828311 CAGCTTGGCCAGAGGGTAGGGGG - Exonic
1166411085 19:42555748-42555770 CAGGCTGACCCCAGGCCAGGAGG - Intronic
1167125275 19:47544943-47544965 CAGGAGGCCCAGAAGGCAGGCGG - Exonic
1167435028 19:49474345-49474367 CAGGGGGAGCAGAGGGTGGGGGG + Intronic
1167529172 19:50004281-50004303 CAGGGTGGGGAGAGGGCAGGAGG - Intronic
1168355625 19:55698066-55698088 CAGGGTGATCAGAGGTCACCTGG + Intronic
925740697 2:7003776-7003798 CAGAGTGGCCACATGGCAGGTGG - Intronic
925868125 2:8246579-8246601 GAGGGAGACCAGAGTGCAGTGGG - Intergenic
925902983 2:8521753-8521775 CAGGGAGACAAGGGGCCAGGTGG + Intergenic
925910086 2:8568121-8568143 CAGTGAGCCCAGAGGCCAGGAGG - Intergenic
926166162 2:10523082-10523104 CAGGGGCAGCAGAGGGCAGTGGG + Intergenic
927519755 2:23691624-23691646 CACGGTGGCCGCAGGGCAGGAGG + Intronic
927711798 2:25330750-25330772 CCGGGAGAGCAGAGGGCATGGGG - Intronic
927876216 2:26656952-26656974 GAGGGTGACCAGGGAGGAGGGGG + Intergenic
927997576 2:27496718-27496740 TGGGGTTACCAGAGGGCTGGGGG + Intergenic
929949421 2:46395045-46395067 CAGGATGACCAGAGGGGAACTGG + Intergenic
930111524 2:47682849-47682871 CAGGGTGACCAGATGTCACCTGG + Intergenic
932186220 2:69698546-69698568 AAGGATGACCAGAGGGCCTGGGG + Intronic
933267684 2:80199920-80199942 CAGGGAGAGCAGAGGGCAGGAGG + Intronic
934534096 2:95118605-95118627 CAGGGATTCCAGAGGGAAGGGGG - Intronic
935145366 2:100391749-100391771 CAGGGTAAGCAGACCGCAGGAGG - Intergenic
935211251 2:100940923-100940945 CAGGGTAGTCAGGGGGCAGGAGG + Intronic
935229356 2:101082406-101082428 CAGGGTGCCCAGCCTGCAGGAGG - Intronic
935578392 2:104734557-104734579 CAGGGTATCCCCAGGGCAGGAGG - Intergenic
935706130 2:105859362-105859384 CAGGGTGAGCCACGGGCAGGTGG - Intronic
936251946 2:110874076-110874098 GAGGATGCCCAGAGGGCAGGTGG + Intronic
936344197 2:111662866-111662888 AAAGGAAACCAGAGGGCAGGAGG - Intergenic
936518423 2:113197084-113197106 TAGGGGGAAAAGAGGGCAGGTGG + Intronic
937128414 2:119489048-119489070 CTGGGTGCCCAGAGGGGAGCAGG + Intronic
937228195 2:120381835-120381857 AAGGGTGACCAGGGAGCAGCCGG + Intergenic
937318539 2:120947268-120947290 AAGGGTGCCCAGATAGCAGGTGG - Intronic
937954815 2:127416238-127416260 CAGGCTGCCCAGAGGGCGGAAGG - Intergenic
938318412 2:130345795-130345817 CAGTAGGACCAAAGGGCAGGTGG - Exonic
938388283 2:130883236-130883258 GAGGGTGGCCAGTGGGCATGGGG + Intronic
938421877 2:131153062-131153084 CAGAATCACCTGAGGGCAGGTGG - Intronic
939195948 2:138972394-138972416 CAGGGTGGAGAGAAGGCAGGAGG + Intergenic
940021043 2:149156186-149156208 TATGGTGATCAGAGGGCATGGGG + Intronic
940898025 2:159099710-159099732 CAGGGTGACCAGATGTCACCTGG - Intronic
941005842 2:160246101-160246123 CATGGTGGTCAGAGGCCAGGGGG + Intronic
941333522 2:164210465-164210487 CAAGGTGTCCACAGGGCTGGGGG - Intergenic
943354551 2:186835917-186835939 TAGGGTCACTAGTGGGCAGGGGG + Intronic
946216466 2:218187571-218187593 AATGGTGACCAGGGGGCTGGAGG + Intergenic
946340132 2:219061108-219061130 CAGGGGGCGCAGAGGGCAGCGGG - Intergenic
946480079 2:220046829-220046851 CAGAGTGTTGAGAGGGCAGGGGG - Intergenic
947463585 2:230323170-230323192 CGGGCTGAACAGAGGGCAGGCGG + Intergenic
947472421 2:230411733-230411755 CGGGCTGAACAGAGGGCAGGCGG + Intergenic
948204401 2:236155525-236155547 CAGGGAGACCAGTGGGCACGGGG - Intergenic
948748053 2:240110059-240110081 CAGGGTGCCCTGGGGGCTGGAGG + Intergenic
948891658 2:240909798-240909820 CAGAGTGAGCAGGGAGCAGGCGG + Intergenic
948936367 2:241167544-241167566 CAGGGAGGCCAGGGTGCAGGAGG - Intronic
949035940 2:241815781-241815803 CAGAGAGAGCGGAGGGCAGGCGG - Intronic
949042848 2:241857516-241857538 CGGGGGAACCAGAGGGCAGAGGG - Intronic
1169388200 20:5168816-5168838 CAGAGGGAGCAGTGGGCAGGAGG - Intronic
1169492662 20:6084202-6084224 CAGGGTGATCACAGAGCAGCCGG - Intronic
1170444134 20:16407539-16407561 CCGGATAACCAGAGGGCAAGAGG + Intronic
1170550508 20:17472172-17472194 CAGGGTGCCCAGAGGGGCTGGGG - Intronic
1170822667 20:19767521-19767543 CTGAGAGACCAGAGGGCAGGAGG + Intergenic
1171561180 20:26127509-26127531 CTGGATCACCAGAGGTCAGGAGG - Intergenic
1172108136 20:32528685-32528707 CAGGGAAACCACAGGGCAGGAGG + Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1173372173 20:42446861-42446883 CAGGATTACCAGATGGAAGGAGG - Intronic
1173552315 20:43941147-43941169 CAGGGTGATGTGAGGGAAGGGGG + Intronic
1173705158 20:45104799-45104821 CAGGGTAAAGAAAGGGCAGGAGG - Intergenic
1173841516 20:46160490-46160512 CAGGGTGACCAGATGGCAACAGG - Intergenic
1174022452 20:47541624-47541646 GAGGGTAACTTGAGGGCAGGAGG - Intronic
1174118078 20:48241639-48241661 CAGGAGGACAACAGGGCAGGAGG - Intergenic
1174339832 20:49888768-49888790 GAGGGAGATCAGATGGCAGGAGG - Exonic
1175894621 20:62330656-62330678 CAGGTTGTCCAGGGGGCAGCAGG - Intronic
1176061765 20:63175673-63175695 TAGGGTGACCCAAGGGAAGGGGG + Intergenic
1178782988 21:35623870-35623892 CAGGATGACCACAGTGGAGGGGG - Intronic
1179272926 21:39865662-39865684 CAGGCTGTGCAGAGGGCATGTGG - Intergenic
1179273486 21:39869555-39869577 GAGGGGGAGAAGAGGGCAGGAGG - Intronic
1179431166 21:41322192-41322214 CTGGGTCACCAGAGGCCTGGGGG - Intronic
1179576313 21:42310535-42310557 CGGGGGGACCACAGTGCAGGAGG + Intergenic
1180491580 22:15853966-15853988 CAGTGTGCCCAGTGGGCATGGGG - Intergenic
1181005947 22:20013586-20013608 CATGGCCACCAGAGGGCAGCTGG - Intronic
1181054909 22:20256289-20256311 CAGGGTCATCAGGGGTCAGGGGG + Intronic
1181284024 22:21739344-21739366 CAGAGTTAGCAGAGGGGAGGAGG - Intergenic
1181311347 22:21946526-21946548 CGTGGTGACCAGATGGCAGGAGG + Intronic
1181388817 22:22564388-22564410 CTGGGTGTACAGAGGGCAGGAGG + Exonic
1181496081 22:23288340-23288362 CAGGGGAACAAGAGGGCTGGGGG - Intronic
1181539591 22:23566268-23566290 CTGGGAGAGGAGAGGGCAGGGGG + Intergenic
1181543623 22:23587967-23587989 CAGGGTGACCAGATGTCACCTGG - Intergenic
1182426943 22:30278572-30278594 CAGGGAGGCCTGAGGGCATGTGG + Intergenic
1182485615 22:30636872-30636894 CAGGGTGAACAGAGGTGTGGTGG - Exonic
1183174844 22:36215616-36215638 AAGGGAGAACAGTGGGCAGGAGG - Intergenic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1183428672 22:37752746-37752768 CAGGGTCCCCGGAGGGCAGAGGG + Intronic
1183455213 22:37918866-37918888 CAGGAGGGGCAGAGGGCAGGAGG - Intronic
1183495846 22:38143303-38143325 CAGGGTGAGCAGAGGTGAGCAGG + Intronic
1183725170 22:39584549-39584571 ATGGGAGACCAGAGGGCTGGGGG + Intronic
1183985637 22:41568771-41568793 CAGAGAGACCAGAGAGCAGAAGG - Intronic
1184248157 22:43246011-43246033 CAGGGAGGCCTGAGGGCTGGTGG + Intronic
1184290994 22:43498168-43498190 CAGGGTGGTCAGAGGGAATGCGG - Intronic
1184465274 22:44665304-44665326 AAGGGTCAGCAGAGGGCAAGAGG + Intergenic
1184526940 22:45029620-45029642 CAGTGTGTCCAGAGAGCAGCAGG + Intergenic
1184650423 22:45917071-45917093 CACAGTGCCCAGTGGGCAGGTGG - Intergenic
1184751520 22:46489062-46489084 CTGGGTGACCAGCAGGAAGGTGG - Intronic
1184795338 22:46728855-46728877 CAGGGTGTGCTGAGGGCAGAGGG + Intronic
1184810020 22:46824907-46824929 CAGGGTGTCAAGTGGGCAGCTGG + Intronic
1185024275 22:48398726-48398748 AAGGCTGAGCAGTGGGCAGGAGG - Intergenic
1185278321 22:49959376-49959398 GAGGGCGCCCAGATGGCAGGTGG + Intergenic
1185393061 22:50573074-50573096 CAGGGTAAGCAGTGGGCACGTGG + Intronic
949765057 3:7516965-7516987 CTGACTGTCCAGAGGGCAGGTGG - Intronic
949828202 3:8185270-8185292 TCAGGAGACCAGAGGGCAGGAGG + Intergenic
950113548 3:10435643-10435665 CAGGGTGACAGGTGGGCAGGAGG + Intronic
950338361 3:12218953-12218975 CAGGATCACCTGAGGCCAGGAGG + Intergenic
950447328 3:13045797-13045819 CAGGGTGGCCCCAGGGAAGGAGG - Intronic
950647539 3:14386287-14386309 CATGGGGACCAGAGGCCATGTGG - Intergenic
950662935 3:14477819-14477841 GAGGGTGAGCAGGGGCCAGGAGG + Intronic
950924646 3:16728416-16728438 GAGGGTGAAAAGGGGGCAGGCGG + Intergenic
952867077 3:37861682-37861704 CAGGGTGAGTGGAGGGCGGGAGG - Intergenic
953373877 3:42412548-42412570 CAGGGTGAGCAGAGGCCATCAGG - Intergenic
953687742 3:45091410-45091432 CAGCGTGCCCAGAGACCAGGTGG - Exonic
953698721 3:45179806-45179828 TAGGGTGCCCTGCGGGCAGGGGG - Intergenic
954302353 3:49706626-49706648 CAGGGTCACCAGAGGGTCAGTGG + Intronic
954452745 3:50580452-50580474 CAGCCTGACCAGAGGGGAGGTGG + Exonic
955833744 3:63031333-63031355 CAGGGTGGCTAGAGGGGATGGGG + Intergenic
956220001 3:66892872-66892894 GAGGGTGAGCAGAAGCCAGGTGG + Intergenic
956689627 3:71863860-71863882 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
958072494 3:88632281-88632303 CAGGGTGACCTGAGGACACCAGG - Intergenic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
961385593 3:126521656-126521678 GAGGGTGCCCCGAGGGCTGGAGG + Intergenic
961491013 3:127257020-127257042 CAGGGTGGCCAGGGAGGAGGCGG - Intergenic
961559107 3:127716752-127716774 CAGGCTGACCTGTGCGCAGGAGG + Intronic
961662199 3:128475360-128475382 CTGGGTCACCGGGGGGCAGGAGG + Intergenic
962427116 3:135280716-135280738 GATGGTTACCAGAGGTCAGGGGG - Intergenic
962693465 3:137924887-137924909 AAGGGAAACCATAGGGCAGGTGG - Intergenic
962945497 3:140165523-140165545 CAGGGTGACGGGAGAACAGGAGG + Intronic
963002881 3:140699685-140699707 CAGAGTTATCAGAGGGCATGAGG - Intronic
964464960 3:156981709-156981731 CAGGTTGCTCAGAGGTCAGGAGG + Intronic
966948713 3:184796605-184796627 CAGGATGAAAAGAGGGCCGGCGG + Intergenic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
967337911 3:188364759-188364781 AATGGTGGCCAGAGGGCAGCAGG - Intronic
967813922 3:193783149-193783171 CCGGGAGACCAGAGGGCTCGAGG - Intergenic
968278460 3:197458325-197458347 CAGGGTGAGTGGAGGGCATGTGG - Intergenic
968365576 3:198182676-198182698 AAGGCTGGCCAGAGGGGAGGTGG - Intergenic
968423660 4:506338-506360 CATCGTGCCCTGAGGGCAGGTGG + Intronic
968430300 4:554549-554571 CTGGCTGAGCAGAGGCCAGGTGG - Intergenic
968461953 4:730588-730610 CAGGGTTACCCGTGGGCCGGAGG - Intronic
968484168 4:850720-850742 CAGGGTGGCCTGAGGCCAGGGGG - Intronic
968922537 4:3530150-3530172 CAGGGTGGTCAGGAGGCAGGAGG - Intronic
968943090 4:3649321-3649343 CAGGATGAACACAGGGAAGGAGG - Intergenic
969045106 4:4330970-4330992 CAGGGTTACAACAGGCCAGGCGG - Intergenic
969307870 4:6336014-6336036 CCGGGTATCCTGAGGGCAGGTGG + Intronic
969465846 4:7355940-7355962 AAGGGAGGGCAGAGGGCAGGTGG - Intronic
969571753 4:8012901-8012923 AAGGGTGAACAGAGGGTAGATGG - Intronic
972945451 4:44248850-44248872 CAGGTTCTCCAGAGGGGAGGAGG - Intronic
973172682 4:47164908-47164930 GAGGGTGACCTAAGGGCAAGAGG - Intronic
973566048 4:52188657-52188679 CAGGGCTACCTGAGGGCAGAGGG - Intergenic
974103601 4:57443420-57443442 CAGGCTGACAAGAGGGCAGGGGG - Intergenic
976136539 4:81943491-81943513 CATGGTTACCAGAGGCTAGGAGG + Intronic
979254610 4:118597843-118597865 AAGGCTGGCCAGAGGGGAGGTGG - Intergenic
979334351 4:119448188-119448210 AAGGCTGGCCAGAGGGGAGGTGG + Intergenic
979831743 4:125314233-125314255 CCAGGTGACTAGGGGGCAGGAGG - Intergenic
980015608 4:127646625-127646647 CAAGGTTACCAGAGGTGAGGGGG - Intronic
981390975 4:144191138-144191160 AAGGGTCACCAGAGAGCAGGAGG - Intergenic
983442952 4:167810604-167810626 CAAGGTGGGCAGAGGGCAAGCGG + Intergenic
984763876 4:183384857-183384879 CATGGTGAGAAGTGGGCAGGGGG - Intergenic
985765642 5:1778055-1778077 CTGGGTGACCAGAGGCCCAGGGG - Intergenic
986748346 5:10762842-10762864 CAGGGTGGCCAGAGAACTGGAGG - Intergenic
987034167 5:14003800-14003822 CAGGGTGGCCTCAGGGCAGTGGG - Intergenic
987181013 5:15368483-15368505 CAGGGTGGCCAGTGTGGAGGTGG - Intergenic
987558348 5:19484576-19484598 AAGTGTGACCTGGGGGCAGGTGG - Intronic
989239021 5:39182230-39182252 CAGTGTGAACAGAGTGCAGGTGG + Intronic
989772490 5:45161401-45161423 CAAGGTGACCAGAAGACAGTGGG - Intergenic
990316624 5:54589149-54589171 GAAGGTGACCGCAGGGCAGGGGG - Intergenic
990329157 5:54708222-54708244 CACGATGACAGGAGGGCAGGTGG - Intergenic
990523176 5:56599510-56599532 CAGGGAGACCTGAGGGGAGGAGG + Intronic
991925479 5:71701573-71701595 CTGGGTGGCAGGAGGGCAGGAGG + Intergenic
993353811 5:86881581-86881603 CAGGGTGACCAAAGGACATGAGG - Intergenic
994875231 5:105413558-105413580 GAGGGTGACCAGAGGCCCAGAGG + Intergenic
995105466 5:108372591-108372613 CATGGAGACCAGAAGGCAGTGGG + Intronic
997764706 5:136489448-136489470 CATGGAGACCAGAAGGCAGTGGG - Intergenic
998761266 5:145434676-145434698 CAGGTTGACCAGGTGGCAGTGGG - Intergenic
998767734 5:145506875-145506897 GAGGGTGACCTGAGCACAGGTGG - Intronic
1000097451 5:157984426-157984448 CAGGGTGATCAGACATCAGGGGG + Intergenic
1000631682 5:163597596-163597618 CATGGTGAACAGAGATCAGGAGG - Intergenic
1001255956 5:170183770-170183792 CAAGGTGAGCAGAGGCCAGAGGG + Intergenic
1002440624 5:179262563-179262585 CAGCGTGACCAAGGGGCAGAAGG - Intronic
1002450744 5:179317143-179317165 CAGAGTGACAGGAGGGCTGGAGG - Intronic
1002635041 5:180603125-180603147 CAGGGCGGGCAGAGGGCTGGAGG - Exonic
1002701908 5:181130509-181130531 CAGGGTGTCCTGGAGGCAGGTGG - Intergenic
1002703889 5:181147637-181147659 CAGGGTGTCCTGGAGGCAGGTGG + Intergenic
1002820128 6:717126-717148 AAGGCTGACCGGAGGGCAGGGGG + Intergenic
1003948179 6:11094076-11094098 CGGGGTGGCCAGAGCGCGGGAGG - Exonic
1004182864 6:13395939-13395961 TGGGATGAGCAGAGGGCAGGCGG + Intronic
1004814093 6:19293886-19293908 CAGGGTGACCTGAGGAAAGTGGG - Intergenic
1005501336 6:26431428-26431450 TTGTGTGACCAGAGGGGAGGAGG - Intergenic
1005505904 6:26468635-26468657 TTGTGTGACCAGAGGGGAGGAGG - Exonic
1005840932 6:29744258-29744280 CAGGCTCACCAGAGGGCACAGGG + Intergenic
1005994482 6:30922998-30923020 CGGGGTGAGCAGAGGGCAGCGGG + Intronic
1006072440 6:31507287-31507309 CAGGCTCACCAGAGGGCACAGGG - Exonic
1006155540 6:32011088-32011110 GAGGGTGGGCAGAGTGCAGGGGG + Intergenic
1006161872 6:32043942-32043964 GAGGGTGGGCAGAGTGCAGGGGG + Intronic
1006381506 6:33700598-33700620 CTGGGCAACCAGAGGCCAGGAGG + Intronic
1006410349 6:33870109-33870131 GAGAGAGAACAGAGGGCAGGTGG + Intergenic
1006457492 6:34140298-34140320 CAACGTGACCAGGGGGCAGTGGG + Intronic
1007150731 6:39688231-39688253 CTGGGAGGCCAGAGGGCAGGAGG + Intronic
1007657747 6:43462151-43462173 CAGAGTGAGCAGAGAGGAGGAGG - Intergenic
1007991658 6:46262331-46262353 CAGGGTGAACAGGGGGCTGATGG - Intronic
1008572822 6:52831269-52831291 CAGGGTGGCCTGAGAGCAGAGGG + Intergenic
1008579769 6:52896235-52896257 CAGGGTGGCCTGAGAGCAGAGGG + Intronic
1009910995 6:69926938-69926960 CATGGAGACCAGAAGGCAGTGGG + Intronic
1011518604 6:88179909-88179931 GCAGGTGATCAGAGGGCAGGAGG - Intergenic
1013860124 6:114625655-114625677 GAAGGTGACCAGATGGCTGGAGG - Intergenic
1013967129 6:115968294-115968316 AACGGAGACCATAGGGCAGGTGG - Intronic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015626364 6:135183158-135183180 CAGGTAGCCCAGAGGGGAGGCGG + Intronic
1016739649 6:147513731-147513753 AAGGGTAAGCAGAGGGTAGGTGG + Intronic
1017816313 6:158019024-158019046 CAGGGTGACAACAGCACAGGTGG - Intronic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018836880 6:167491931-167491953 AAGGGCGTCCAGAGGACAGGAGG - Intergenic
1019511831 7:1421608-1421630 CAGGGTGTCCCGAGGGCCAGGGG + Intergenic
1019557750 7:1641103-1641125 GAGGGGGACCAGTGGGCAGGTGG - Intergenic
1019566096 7:1679750-1679772 GAGTGTGGCCAGGGGGCAGGGGG - Intergenic
1019605678 7:1909050-1909072 CAGTGGGAACACAGGGCAGGAGG + Intronic
1019660163 7:2219667-2219689 CAAGGGGGGCAGAGGGCAGGGGG + Intronic
1020040750 7:4999007-4999029 AAGGATGACCAGAGGGCTTGGGG + Intronic
1021030956 7:15735205-15735227 CAGGGTGGCCAGCCTGCAGGCGG - Intergenic
1021851615 7:24814212-24814234 CAGTGTGGCCAGAGGACAGTGGG + Intronic
1022549104 7:31220169-31220191 CAGGGTGACCAGTTGGAAGAAGG - Intergenic
1022801337 7:33780142-33780164 CAGGGTGACCAAGAAGCAGGTGG - Intergenic
1024069705 7:45775509-45775531 GAGGCTGGCCAGAGGGGAGGTGG - Intergenic
1024499942 7:50093958-50093980 CTGGGTAAAAAGAGGGCAGGTGG - Intronic
1025005997 7:55355338-55355360 CAGGGTGATCAGAGGTCACCGGG + Intergenic
1025901855 7:65751174-65751196 CAAGGTGGCCGGAGCGCAGGCGG + Intergenic
1026461393 7:70618331-70618353 CAGGGTGACCAGATCACAGGAGG - Intronic
1026894910 7:74004302-74004324 CTGGGTTAGCAGGGGGCAGGGGG + Intergenic
1026914210 7:74110121-74110143 GAGGGTCACTAGAGGTCAGGAGG + Intronic
1027357713 7:77375469-77375491 GAAGGAGAGCAGAGGGCAGGAGG + Intronic
1029409455 7:100399455-100399477 CAGGGTCACGTGAGGGCAAGGGG - Intronic
1031357090 7:120800482-120800504 CAGGGTGATCAGACGTCAGCTGG - Intronic
1031554233 7:123151877-123151899 CAGGGTGACAACAGTGGAGGTGG - Intronic
1031973415 7:128079376-128079398 CTGGCTGGCCAGAGGGGAGGAGG - Intronic
1031975242 7:128089574-128089596 CAGGGTGACATGGGGGCAGCCGG - Exonic
1032525406 7:132575958-132575980 CAGGGTGTCCAAAGGCCACGGGG + Intronic
1033239161 7:139663015-139663037 CATGGTGGCCAGTGGGAAGGTGG - Intronic
1033353973 7:140584661-140584683 CTGAATGCCCAGAGGGCAGGGGG - Intronic
1034095535 7:148404699-148404721 CTGGGTACCAAGAGGGCAGGGGG - Intronic
1035042120 7:155936515-155936537 CAGGATGACCACTGGGCAGAGGG - Intergenic
1035391600 7:158508148-158508170 CACGGTGGGCAGAAGGCAGGTGG + Intronic
1035587157 8:785533-785555 CAGAGAGACCTGAGGGGAGGAGG - Intergenic
1035629183 8:1095324-1095346 CAGGGTCTGCAGAGGGCAGGTGG - Intergenic
1036458743 8:8932596-8932618 CAGGGTGGCCAAATGGCAAGTGG - Intergenic
1037776242 8:21837810-21837832 TAGGGTGGGCAGAGGGAAGGAGG - Intergenic
1037803096 8:22045573-22045595 TAGGGTCACCAGAGAGCATGTGG - Intronic
1038613783 8:29075280-29075302 CAGGGTGACCAGGATGGAGGAGG - Exonic
1038779567 8:30558342-30558364 TAGGGTGAACAGAGGGCCTGGGG + Intronic
1039216550 8:35278235-35278257 GAGTGTGGCCAGAGGGCAGCCGG - Intronic
1039425213 8:37479684-37479706 CAGGGGGAGCACAGGACAGGTGG + Intergenic
1039447466 8:37644073-37644095 AAGGGTGAGCAGAAGGCAGGTGG + Intergenic
1039912475 8:41835946-41835968 CAGGGAGGGGAGAGGGCAGGGGG + Intronic
1040481458 8:47831445-47831467 CACGGTGCCCCGAGGACAGGTGG - Intronic
1040672124 8:49704424-49704446 CAGGGTGACCTGGGGGATGGTGG - Intergenic
1042310507 8:67374700-67374722 CAGGTGGACCAGAGAGAAGGTGG - Intergenic
1043562620 8:81512018-81512040 AAGGGACACCAAAGGGCAGGAGG + Intergenic
1043890061 8:85644356-85644378 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043891602 8:85656270-85656292 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043892674 8:85663107-85663129 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043892883 8:85714228-85714250 CAGGCTGATGAGAGGGCAGTGGG - Intergenic
1043895570 8:85735682-85735704 CAGGCTGATGAGAGGGCAGTGGG - Intergenic
1043897109 8:85746126-85746148 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043899435 8:85764494-85764516 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043901043 8:85776687-85776709 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043903007 8:85791962-85791984 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043904617 8:85804155-85804177 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043906229 8:85816346-85816368 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1043907837 8:85828536-85828558 CAGGCTGATGAGAGGGCAGTGGG + Intergenic
1044637586 8:94342041-94342063 CTGGGTGGCCTGGGGGCAGGGGG - Intergenic
1044854487 8:96461002-96461024 CAGGCTCACCAGAAAGCAGGTGG + Intergenic
1044866248 8:96574014-96574036 GAGGGGGTGCAGAGGGCAGGGGG - Intronic
1047670018 8:127135953-127135975 CAGAGTGAGAAGAGGGCTGGAGG - Intergenic
1048955655 8:139533876-139533898 CAGGCTGACCTCAGGACAGGGGG + Intergenic
1049189706 8:141280219-141280241 CAGGGTGGGCAGGGGGCACGTGG - Intronic
1049371913 8:142272008-142272030 CGGGTAGACCAGAGGGCAGGCGG - Intronic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049403374 8:142440807-142440829 CTGGGTAGACAGAGGGCAGGAGG - Intergenic
1049682681 8:143926629-143926651 CAGGCTGAGCTGGGGGCAGGGGG + Intronic
1049696787 8:143987974-143987996 CAGGGTGTGCAGGGGGCATGGGG - Intronic
1049757379 8:144316739-144316761 CATGGTGACCACAGGGCTGGGGG + Intronic
1049759937 8:144327378-144327400 CGGGGTAACCAGAGGGCTCGCGG - Intergenic
1049782745 8:144436263-144436285 CAGGGTCTCCCCAGGGCAGGCGG - Exonic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1050151274 9:2621770-2621792 CGGGGTGAGCAGCGGGGAGGGGG - Intergenic
1051009013 9:12387258-12387280 CAGTTTGACCAGAGGCCAGTGGG - Intergenic
1053416890 9:37952434-37952456 CACTGTGAGCAGCGGGCAGGAGG + Intronic
1053440203 9:38109727-38109749 CAGGCTGAAGAGAGGGCAGCTGG + Intergenic
1053462584 9:38282021-38282043 GAGGCTGAGCAGAGGGCAGAGGG + Intergenic
1053893856 9:42724310-42724332 CAGGGAGACCTGAGGAGAGGGGG - Intergenic
1054260715 9:62862668-62862690 CAGGGTGAAGAGTGGGCAGCAGG - Intergenic
1055977838 9:81971956-81971978 CAGGCTCACTAGAGGGCAGCAGG - Intergenic
1056468147 9:86879126-86879148 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
1056628411 9:88273170-88273192 CAGGGTGACCAGGAGGCCGTCGG + Intergenic
1056850894 9:90082640-90082662 CAGGGTGACAGGTGGGCAGGTGG + Intergenic
1057185272 9:93053958-93053980 CAAGGCGCCCAGAGGGCAGAAGG - Intergenic
1057460233 9:95254424-95254446 GAGGGTGAGCAGAAGCCAGGTGG + Intronic
1057550889 9:96050200-96050222 CAGAGTCGCCAGATGGCAGGAGG + Intergenic
1057762483 9:97888083-97888105 AAGAGTGACAAGAGGGAAGGAGG - Intergenic
1057910077 9:99013309-99013331 CTGGGTGACTGGAGGGCAAGTGG - Intronic
1060171057 9:121461524-121461546 CAGGATGAGCTGAGGGCTGGGGG - Intergenic
1060530538 9:124344924-124344946 AAGGGTGACTGGAGGCCAGGAGG - Intronic
1060705094 9:125791552-125791574 CAGGAGGAAGAGAGGGCAGGGGG - Intronic
1060981656 9:127795863-127795885 CAGGGTGACCAGACAGGTGGTGG + Intronic
1061328547 9:129878568-129878590 CAGGGTGAACAGAGAGCATGGGG + Intronic
1061368971 9:130187307-130187329 CACGGTGCTCAGAGAGCAGGAGG - Intronic
1061386017 9:130289775-130289797 CAGGGTGCCCAGCTGGCAAGGGG + Intronic
1062053200 9:134457760-134457782 CAGGATGACCCCAGGGCAGGAGG - Intergenic
1062144345 9:134980625-134980647 CTGGGTGGCCGGGGGGCAGGTGG + Intergenic
1062152679 9:135030070-135030092 GTGGGTGACCAAGGGGCAGGTGG - Intergenic
1062469398 9:136695937-136695959 CAGGATGCACAGAGGGAAGGGGG - Intergenic
1062599440 9:137313335-137313357 CAGGGTGGCCGGCAGGCAGGAGG - Intronic
1062610018 9:137369427-137369449 CAGGAGGAGCAGAGGGCGGGCGG - Intronic
1062749945 9:138245543-138245565 AAGGCTGGCCAGAGGGGAGGTGG - Intergenic
1189308180 X:40002943-40002965 CAGGGTGCAGAGAGGGGAGGAGG + Intergenic
1190846233 X:54193694-54193716 CAGGGTGACCTGAAGGCATTTGG + Exonic
1192359676 X:70431544-70431566 CATAGTGCCCAGAGGACAGGAGG + Intronic
1196205613 X:112935993-112936015 CAAGATGACCAGAGTGCTGGAGG + Intergenic
1196818736 X:119686171-119686193 CAGGCTCCCCAGAGGGCAGTTGG - Intronic
1198421643 X:136474487-136474509 CAGGGTGAAGTGAGGGAAGGGGG + Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200056494 X:153464101-153464123 CAGGCTTGTCAGAGGGCAGGTGG - Intronic
1200223629 X:154404629-154404651 CAGAGTGTCCATAGAGCAGGAGG - Intronic
1202195292 Y:22294595-22294617 GAGGGTGTCCTGAGGGCACGTGG + Intergenic