ID: 1113896573

View in Genome Browser
Species Human (GRCh38)
Location 13:113768441-113768463
Sequence CCCAGAGCTGGGGCTTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 648
Summary {0: 1, 1: 0, 2: 10, 3: 73, 4: 564}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1113896563_1113896573 15 Left 1113896563 13:113768403-113768425 CCCATGTCTATTTCCCGACATCC 0: 1
1: 0
2: 0
3: 8
4: 87
Right 1113896573 13:113768441-113768463 CCCAGAGCTGGGGCTTCCTGTGG 0: 1
1: 0
2: 10
3: 73
4: 564
1113896567_1113896573 -6 Left 1113896567 13:113768424-113768446 CCCAGTATCATTTTCTGCCCAGA 0: 1
1: 0
2: 0
3: 17
4: 205
Right 1113896573 13:113768441-113768463 CCCAGAGCTGGGGCTTCCTGTGG 0: 1
1: 0
2: 10
3: 73
4: 564
1113896565_1113896573 2 Left 1113896565 13:113768416-113768438 CCCGACATCCCAGTATCATTTTC 0: 1
1: 0
2: 1
3: 17
4: 260
Right 1113896573 13:113768441-113768463 CCCAGAGCTGGGGCTTCCTGTGG 0: 1
1: 0
2: 10
3: 73
4: 564
1113896564_1113896573 14 Left 1113896564 13:113768404-113768426 CCATGTCTATTTCCCGACATCCC 0: 1
1: 0
2: 0
3: 14
4: 109
Right 1113896573 13:113768441-113768463 CCCAGAGCTGGGGCTTCCTGTGG 0: 1
1: 0
2: 10
3: 73
4: 564
1113896566_1113896573 1 Left 1113896566 13:113768417-113768439 CCGACATCCCAGTATCATTTTCT 0: 1
1: 0
2: 3
3: 39
4: 351
Right 1113896573 13:113768441-113768463 CCCAGAGCTGGGGCTTCCTGTGG 0: 1
1: 0
2: 10
3: 73
4: 564
1113896568_1113896573 -7 Left 1113896568 13:113768425-113768447 CCAGTATCATTTTCTGCCCAGAG 0: 1
1: 0
2: 0
3: 14
4: 193
Right 1113896573 13:113768441-113768463 CCCAGAGCTGGGGCTTCCTGTGG 0: 1
1: 0
2: 10
3: 73
4: 564

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1113896573 Original CRISPR CCCAGAGCTGGGGCTTCCTG TGG Intronic
900097997 1:948139-948161 CCCGGAGCTGGTGCTGCCTGTGG - Exonic
900484281 1:2914131-2914153 AGCAGAGCTGGGTCTTCCAGTGG + Intergenic
900610635 1:3543167-3543189 CCCAGGGCCGGGGCACCCTGAGG + Intronic
900830920 1:4964837-4964859 CCCAGAGCTGGTGCTTCCTCAGG + Intergenic
900962946 1:5937228-5937250 ACCACACCTGGGGTTTCCTGGGG + Intronic
901055112 1:6445716-6445738 CCCGGAGCTGGGCCTGCCTCGGG + Exonic
901236609 1:7670665-7670687 GCCGGTCCTGGGGCTTCCTGAGG + Intronic
901642621 1:10700597-10700619 TCCAGAGCTGGTGCTCCATGAGG - Intronic
901911220 1:12459884-12459906 CCCAGAGCTTGGGCAGCCTACGG - Intronic
902479257 1:16702898-16702920 CCCAGAGCTGGGCCTGCCTTGGG - Intergenic
902816093 1:18917597-18917619 GCCAGATCTGGGCCTCCCTGGGG - Intronic
902957471 1:19935318-19935340 CCCAGGGCCTGGGCTTCCAGAGG - Intergenic
903126491 1:21251733-21251755 CCCAGAGCTGGTTCCTCCTGGGG - Intronic
903141996 1:21344700-21344722 CTCAGAGGAGGGGCTTGCTGAGG - Intronic
903183109 1:21614978-21615000 CCCTGAGCTGCGGATTCGTGGGG - Intronic
903540538 1:24093843-24093865 CTCAGAGCTGGGGGTGCCAGAGG + Intronic
904035830 1:27558070-27558092 CCTAGAGCTGAGCCTGCCTGGGG - Intronic
904744252 1:32701721-32701743 CCCTGACCTCGGGCTTCCTTGGG + Intronic
904775721 1:32905014-32905036 CCCAGGGCAGGGGCTCCCAGGGG + Intergenic
904805298 1:33127249-33127271 CCGTGAGCTGGGGGTTCCGGTGG - Intergenic
905279716 1:36841372-36841394 CCCATAGCTGGGGCATCCTCTGG + Intronic
905326130 1:37153270-37153292 CACAGAGCTGGGGGATGCTGGGG - Intergenic
906128044 1:43439570-43439592 CCCAGAGCTGAGCCTTCCTATGG + Intronic
906528264 1:46508929-46508951 CCCTGAGCTGAGTCATCCTGGGG - Intronic
906746649 1:48226539-48226561 CCCAGAGCTGGTTCTTACTCTGG - Intronic
906777061 1:48539378-48539400 CACAGGGATGGGGCTTGCTGGGG - Intronic
910157357 1:84234385-84234407 CCCAGAGGTGGAGCTTACAGAGG + Intronic
911034905 1:93532049-93532071 CTCAGAGCTGGGGATACGTGAGG - Intronic
911264798 1:95730673-95730695 CCAAGAGGTGGTGCTTCCTGTGG - Intergenic
912512679 1:110199481-110199503 CCCAGGAGTGAGGCTTCCTGGGG - Exonic
912795342 1:112689750-112689772 CCTTGGGATGGGGCTTCCTGGGG + Intronic
913047755 1:115088908-115088930 CCCTGCCCTGGGGCTGCCTGGGG - Intronic
913337395 1:117721205-117721227 CCCAGAGGTGGGGCCTACAGAGG - Intergenic
913613115 1:120528114-120528136 GCCAGACTTGAGGCTTCCTGAGG + Intergenic
914003890 1:143716319-143716341 CCCAGAAGTTGGGGTTCCTGGGG + Intergenic
914357995 1:146904487-146904509 CCCAGAGGTGGGGATTATTGAGG + Intergenic
914371467 1:147028866-147028888 GCCAGACTTGAGGCTTCCTGAGG + Intergenic
914578072 1:148994133-148994155 GCCAGACTTGAGGCTTCCTGAGG - Intronic
915314102 1:155018330-155018352 CCCAGGGCTGGGGAGACCTGGGG + Exonic
915579503 1:156805003-156805025 CCCAGGCCTGGGGACTCCTGTGG - Intergenic
916636071 1:166670040-166670062 CCCAGACCTTGGTTTTCCTGAGG - Intergenic
917249612 1:173043770-173043792 CCAAGAGCTGAGGCTTTCAGAGG - Intronic
918521805 1:185423239-185423261 CCCACACCTGTGGCTTCATGGGG + Intergenic
919760919 1:201097534-201097556 CACAGAGCTGGTGCTCCCTGTGG - Intronic
919844838 1:201635518-201635540 TCCAGAGCTGGGGCTTCTCCAGG - Intronic
920555236 1:206899538-206899560 CCCAGTCGTGGGGGTTCCTGGGG + Intronic
921852014 1:219941437-219941459 CCCAAAGCAGGGGCTTCAAGTGG + Intronic
922182085 1:223243340-223243362 TGGAGAGATGGGGCTTCCTGGGG + Intronic
922504678 1:226119665-226119687 GCCAGACCTGGGGCTTCAGGTGG - Intergenic
922620517 1:226985443-226985465 CCCAGAGCCCGGGCCTCCTTGGG + Intronic
924591014 1:245404407-245404429 CTCAGGGCTGGGGATCCCTGAGG + Intronic
924772149 1:247087941-247087963 CCCTGAGCTGTGGGTTCCTGTGG - Intergenic
1062886521 10:1020772-1020794 AGCAGAGCTGGGAATTCCTGGGG - Exonic
1065100353 10:22325527-22325549 CCCAGCGCTGTGGCCTCGTGGGG + Intronic
1065554945 10:26905825-26905847 CCCCGAGCTGTGGGCTCCTGTGG + Intergenic
1065805195 10:29387616-29387638 CACAGAGCTTGGGCTGCCCGAGG + Intergenic
1067657895 10:48211122-48211144 ACAAGACATGGGGCTTCCTGGGG + Intronic
1068348817 10:55817514-55817536 CCCAGTTCTAGGGTTTCCTGAGG + Intergenic
1069711000 10:70488707-70488729 CCCTGAGCTGGGGCTTGGCGAGG + Intronic
1069902899 10:71716073-71716095 GCCGGAGCTGGGGCTCACTGGGG + Exonic
1070474045 10:76814802-76814824 CCCAGAGGTGGAGCTTACGGAGG + Intergenic
1070474150 10:76815593-76815615 CCCAGAGGTGGAGCTTACCGAGG + Intergenic
1070934471 10:80282582-80282604 CCCAGAGCTGCAGCTTCCTGAGG - Intronic
1071262642 10:83934793-83934815 CCCAGAGCTCAGACCTCCTGTGG - Intergenic
1072010538 10:91299256-91299278 CCCAGGTCTGGCACTTCCTGAGG + Intergenic
1073122948 10:101133125-101133147 GGCAGAGATGGGGCCTCCTGGGG + Intronic
1073353005 10:102832943-102832965 CCCAGAGATTGGGCTGGCTGGGG + Intronic
1073469704 10:103714983-103715005 GCCAGGGCTGGTGCTGCCTGTGG - Intronic
1074205788 10:111281649-111281671 CCCAGATCTGGGGCAGCCTGAGG - Intergenic
1074813871 10:117130541-117130563 CCAATAGCTGGGCCTGCCTGGGG - Intronic
1075668345 10:124246262-124246284 CTCAGAGCCGGGGCTCCCTGAGG - Intergenic
1075838263 10:125474768-125474790 CCCAGAGGTAGGGCTTCCACTGG + Intergenic
1076049412 10:127320785-127320807 CCCAGATCCAGGGTTTCCTGGGG - Intronic
1076810442 10:132883848-132883870 TCCAGATCTGTGGCTTGCTGGGG + Intronic
1076853114 10:133102822-133102844 ACCTGAGCAGGGGCTGCCTGGGG - Exonic
1076882961 10:133248399-133248421 TCCACAGCTGGGGCTCCCTGAGG + Intergenic
1077048691 11:557081-557103 GCCAGGGCCGGGGCTGCCTGTGG + Exonic
1077062917 11:625638-625660 CCTAGAGCTGGGGGCTTCTGGGG - Intronic
1077077048 11:706591-706613 CCCAGCTCTGGGGCTTGGTGGGG + Intronic
1077186011 11:1235693-1235715 CCCTGGGCTGTGGCTGCCTGTGG + Intronic
1077343605 11:2036701-2036723 CCCAGACTTGGGGCTTCCTTTGG + Intergenic
1077564122 11:3285604-3285626 CCCAGAGGTGGGGATCACTGGGG - Intergenic
1077570012 11:3331421-3331443 CCCAGAGGTGGGGATCACTGGGG - Intergenic
1078345189 11:10541392-10541414 CCCGGAGCAGGGGCTTCATGAGG + Intergenic
1079451196 11:20601230-20601252 CCCGGAGCAGGAGCTTCCCGCGG + Exonic
1080716389 11:34805960-34805982 CCCACAGCTAGTGCTTACTGAGG + Intergenic
1081439245 11:43062290-43062312 CCCAGGGCATGGCCTTCCTGTGG + Intergenic
1081647535 11:44800341-44800363 CCCAGAGCTGGGGGATCTGGCGG + Intronic
1082162848 11:48902271-48902293 GCCAGAGCTAGGGCTTCCCTGGG - Intergenic
1082577929 11:54832820-54832842 CCCAGAGGTGGAGCCTACTGAGG + Intergenic
1082890974 11:58138251-58138273 TCCCCAGCTGGGGCTGCCTGAGG + Intronic
1083305843 11:61761582-61761604 GCCAGGGCCGGGGCTACCTGGGG - Intronic
1083436828 11:62648570-62648592 CCAAGAGCTGGTGCTGCCAGAGG + Exonic
1083681587 11:64354127-64354149 CCCGGAGACGGAGCTTCCTGAGG + Exonic
1083688196 11:64390345-64390367 CCCAGAGCTGGGGAGGCCTCAGG + Intergenic
1083860070 11:65415625-65415647 CCCACAGCTGAGGCTTCATGTGG + Intergenic
1084024385 11:66438703-66438725 CGCCGACCTCGGGCTTCCTGAGG + Exonic
1084174882 11:67417900-67417922 CCCAGGGCTGGGTCTTTTTGGGG - Intronic
1084518056 11:69647014-69647036 CCCTCACCTGGGGCTTCCTGGGG - Intronic
1084748968 11:71191402-71191424 CACAGGGCTGGGTCCTCCTGAGG + Intronic
1084844486 11:71888476-71888498 CCCAGGGCTGGGGCTGCCAGAGG - Intronic
1084934367 11:72579133-72579155 GCCAGTGCTGGGTCTGCCTGGGG + Intronic
1084951100 11:72665965-72665987 GCCAGAGGAGGGGCTTCCTCTGG - Intronic
1085022038 11:73216109-73216131 CCCTTACCTGGGGCTGCCTGGGG - Intergenic
1085022061 11:73216181-73216203 CCCAGCGATGGGACTGCCTGGGG + Intergenic
1085046151 11:73354908-73354930 CCCTGAGCTGGGCTTTACTGTGG + Intronic
1085259229 11:75194678-75194700 CTCAGACCAGGGACTTCCTGAGG - Intronic
1085269816 11:75263591-75263613 CCCTGACCATGGGCTTCCTGAGG + Intergenic
1085443100 11:76580589-76580611 CCCAGAGGAGGGGCCTTCTGAGG + Intergenic
1087051056 11:93886876-93886898 CACAGAGATGGTGCCTCCTGGGG + Intergenic
1087818005 11:102679969-102679991 CACAGAGCTGCAGCTTCCTCAGG - Intergenic
1089158116 11:116417381-116417403 CCCTCAGCTGTTGCTTCCTGTGG + Intergenic
1089381572 11:118036572-118036594 CCCTAAGCTGGGGGTGCCTGGGG + Intergenic
1090180451 11:124694177-124694199 CTGAGAGCTGTTGCTTCCTGAGG - Intronic
1090349845 11:126101023-126101045 CTCAGAGCAGGGGCTGCCTGAGG + Intergenic
1090359534 11:126162899-126162921 CACAGAGCTGGGGATTTGTGGGG - Intergenic
1090400153 11:126443768-126443790 CCCAGAGCAGGGCCCTCCTGAGG - Intronic
1090500436 11:127255601-127255623 GTCTGAGCTGGGGCTTCCTCTGG + Intergenic
1202826591 11_KI270721v1_random:91890-91912 CCCAGACTTGGGGCTTCCTTTGG + Intergenic
1091646075 12:2273473-2273495 CCCAGAGCCGGCTCTTTCTGTGG + Intronic
1091779471 12:3204862-3204884 CCCAGAGATGGGGCTGACTGAGG - Intronic
1092053365 12:5489264-5489286 CTTAGAGCTGAGGCTTCTTGGGG + Intronic
1092061197 12:5551911-5551933 CAAAGAGCTGGGAGTTCCTGGGG + Intronic
1094480592 12:30878245-30878267 CCCATAGCTGAGGCTGCCAGAGG - Intergenic
1095073853 12:37892938-37892960 CCCAGAGTTGGAGCCTACTGAGG - Intergenic
1096292123 12:50351961-50351983 CCCAGAGCCTGGGCCTGCTGAGG + Exonic
1096524299 12:52201341-52201363 TCTCCAGCTGGGGCTTCCTGAGG - Intergenic
1096892822 12:54789104-54789126 CCCAGAGGTGGAGCTTACAGAGG - Intergenic
1096912277 12:54996473-54996495 CCCAGAACTGGGTCTTCCCTAGG - Intergenic
1096962158 12:55590470-55590492 CCCAGAGGTGGGGCCTACAGAGG - Intergenic
1100038513 12:90282187-90282209 CACAGAGGTGGAGCTTCCTAAGG + Intergenic
1100855062 12:98750831-98750853 CCCGCAGCTGAGGCTTCCTGCGG - Intronic
1100884182 12:99051158-99051180 CCCAGTGCCGGGGGTACCTGTGG - Intronic
1101309230 12:103561236-103561258 CACAAAGCTGGGGCTTGCTCTGG - Intergenic
1101986805 12:109453513-109453535 CCCAGACCTGAGCATTCCTGTGG + Intronic
1102012734 12:109628589-109628611 CCCGGAGCTGGCTCTTCCTCGGG + Intergenic
1102902589 12:116649862-116649884 CCCAGACCGGGGGCTGCCAGGGG + Intergenic
1103623328 12:122201573-122201595 CTTGGAGCTGGGGCTGCCTGGGG + Intronic
1103883213 12:124182495-124182517 CCCAGGGCGAGGGCTTCCCGAGG - Intronic
1104320812 12:127749176-127749198 CTGAGAGTTGGGGCTTCTTGGGG - Intergenic
1104487190 12:129161905-129161927 CCCAGAGAGGGGGATTCCTCTGG + Intronic
1104689893 12:130818001-130818023 CCCACTGCAGGGCCTTCCTGGGG - Intronic
1104740883 12:131172877-131172899 CTCAGTGCTGGGGTTTACTGAGG - Intergenic
1104799400 12:131543647-131543669 GCTCGAGCTGGAGCTTCCTGGGG - Intergenic
1104958460 12:132477088-132477110 CCCAGAGCTGGGGAGGCCAGTGG - Intergenic
1105606526 13:21930702-21930724 CCAGCAGCTGGGGCTTCCTGAGG - Intergenic
1106176338 13:27335643-27335665 GCCTGAGCTGGGGGTTCCTGAGG + Intergenic
1106419255 13:29572088-29572110 CCCAGGTCTGAGGCTGCCTGTGG + Intronic
1106434186 13:29709194-29709216 CCAGGGGCTGGGGGTTCCTGGGG - Intergenic
1107026744 13:35809707-35809729 CCCTCAGGTGGGGCTGCCTGGGG - Intronic
1107282740 13:38755345-38755367 CCCACCCCTGGGGGTTCCTGGGG - Intronic
1107336700 13:39363151-39363173 CTCACAGCTGGAGCTGCCTGGGG - Intronic
1110415415 13:75246755-75246777 CCCAGAGGTGGAGCTTACAGAGG + Intergenic
1111106100 13:83647597-83647619 CCCAGTGCTGGGTTTTACTGTGG + Intergenic
1111513615 13:89298149-89298171 CCCTGTGGTGGGGCTGCCTGGGG + Intergenic
1112343890 13:98575597-98575619 CCCAGACCTGGGACTGCCTCTGG - Intronic
1113563609 13:111303730-111303752 CCCAGACCTGCGGGTTTCTGAGG + Intronic
1113843077 13:113371377-113371399 CCCAGGGCTGGCTCTTCCTGAGG + Intergenic
1113896573 13:113768441-113768463 CCCAGAGCTGGGGCTTCCTGTGG + Intronic
1113961516 13:114128790-114128812 CTCCCCGCTGGGGCTTCCTGTGG - Intronic
1116346783 14:43803712-43803734 CCTATAGATGTGGCTTCCTGAGG - Intergenic
1118741428 14:68742226-68742248 AGCAGAGCTGGGGCTCCCTGTGG - Intergenic
1118896431 14:69949462-69949484 CTCAGAGCTGGGGATTCCACTGG + Intronic
1118974648 14:70666213-70666235 CCCAGCCCTGTGGCTCCCTGTGG + Intronic
1119185905 14:72642397-72642419 CCCAGTGCTGGGCCTCACTGTGG - Intronic
1119640224 14:76309207-76309229 CCCAGTTCTGGGCCTTCCTAGGG + Intergenic
1119829404 14:77687779-77687801 TCCTGTGCTGAGGCTTCCTGGGG + Intronic
1120036455 14:79703936-79703958 CCTAGAGCTTAGCCTTCCTGTGG + Intronic
1120400259 14:84022529-84022551 CCCAGGAATGGGGTTTCCTGTGG + Intergenic
1121105881 14:91279423-91279445 CCCAGAGCTCCTCCTTCCTGAGG - Intronic
1121265593 14:92600364-92600386 CCAAGAGCTGGGGCTGCCCCAGG + Intronic
1121580313 14:95025151-95025173 CCCACCAGTGGGGCTTCCTGGGG + Intergenic
1121650235 14:95552772-95552794 CACAGAGCGGGGGTCTCCTGGGG + Intergenic
1121834233 14:97077509-97077531 CTCAGACCAGGGGCGTCCTGAGG + Intergenic
1121916989 14:97844409-97844431 CACAGAGCTTGGGTTTCATGGGG - Intergenic
1122074981 14:99230168-99230190 CCTGGAGCAGGGGCTGCCTGTGG + Intronic
1122090264 14:99333965-99333987 CCCAGACCTGGGGCTCCCCAGGG - Intergenic
1122153230 14:99735734-99735756 CCCACAGATAGGGCTTCCTTTGG + Intergenic
1122232583 14:100314084-100314106 GGCAGAGCTGCGTCTTCCTGGGG + Intergenic
1122615801 14:103016913-103016935 CCCAGCTCTGGAGCTGCCTGAGG - Intronic
1122775334 14:104114456-104114478 CCCAGTCCCGGGGCTCCCTGTGG - Exonic
1122975874 14:105170504-105170526 CCCCGGGCTGGGGGCTCCTGAGG - Intergenic
1123117288 14:105900466-105900488 ACAAGAGCTGGGGATTCCGGCGG - Intergenic
1125506974 15:40272682-40272704 CCCTGCGCTGCTGCTTCCTGAGG - Exonic
1126109525 15:45167368-45167390 CCCGGAGCCGGGGCGGCCTGGGG + Exonic
1127383368 15:58448364-58448386 CTCAGGACTGGGGCTTTCTGGGG + Intronic
1128059851 15:64728428-64728450 CCCAGAGCTGGTTCTTCCTCAGG + Intergenic
1128081874 15:64861676-64861698 CCTGGAGCTGGGGCTTCCTGAGG + Intronic
1128517055 15:68348972-68348994 CCCACAGCTCCTGCTTCCTGGGG + Intronic
1128998781 15:72316397-72316419 ACAAGAGCTGGGGGCTCCTGGGG - Intronic
1129461301 15:75701365-75701387 ACCAGTGCTGGGACTTGCTGTGG - Intronic
1130703651 15:86211438-86211460 CCCAGAGCTGGGGTCTACAGAGG + Intronic
1132348589 15:101123111-101123133 CCCAAAGCTGGTGCTACCTCAGG - Intergenic
1132405299 15:101538383-101538405 CCCCAACCTGGGGTTTCCTGGGG - Intergenic
1132507634 16:319647-319669 CCCAGAGAGGTGCCTTCCTGGGG - Intronic
1132582697 16:692806-692828 CTCAGCCCTGGAGCTTCCTGGGG + Exonic
1132648880 16:1011569-1011591 CCCTCACCTGGGGCTTCCGGAGG + Intergenic
1132725894 16:1338248-1338270 CCCAGAGCTGGGGGTCCATCAGG - Intronic
1133023118 16:2975546-2975568 CCCAGGTCTGGGGCTACCTGCGG - Exonic
1133218924 16:4310029-4310051 TACAGAGCTGGGGCTGTCTGCGG - Intergenic
1134092565 16:11399396-11399418 CCCAGAGCTGGACGCTCCTGTGG + Intronic
1134183778 16:12067322-12067344 TACAGAGCTGGGGGTTCTTGGGG + Intronic
1134633942 16:15778059-15778081 CCTAGGGCTCAGGCTTCCTGTGG - Intronic
1134809347 16:17154109-17154131 CCCAGCGTGGGGCCTTCCTGTGG + Intronic
1134837066 16:17370035-17370057 CCCACAGCTGGGGCTTTGTAAGG - Intronic
1135429816 16:22374048-22374070 CCCCGTGCCGAGGCTTCCTGCGG + Intronic
1136026064 16:27469821-27469843 AACAGAACTGGGGCTTCCTGGGG - Intronic
1136065466 16:27755384-27755406 CCCTGAGATGGAGTTTCCTGGGG + Intronic
1136146606 16:28320069-28320091 CCCGCAGGTGGGGCTCCCTGAGG + Exonic
1136686423 16:31997271-31997293 CTCAGACCTTGGGCTTCCAGGGG - Intergenic
1136787034 16:32940800-32940822 CTCAGACCTTGGGCTTCCAGGGG - Intergenic
1136938930 16:34501313-34501335 CCCACCACTGGGGCTTTCTGTGG - Intergenic
1136960890 16:34847243-34847265 CCCACCACTGGGGCTTTCTGTGG + Intergenic
1137798923 16:51244847-51244869 CCCAGTGCTGGGGCCTGCTTGGG - Intergenic
1138157567 16:54720404-54720426 CCCAGAGCTGGGTCTTCTGATGG + Intergenic
1138203500 16:55107346-55107368 CCCAGTGCCTGGGCTTCTTGAGG + Intergenic
1138432169 16:56975918-56975940 CCCACACCTGCGCCTTCCTGCGG + Intronic
1138660314 16:58512635-58512657 GCCTGGGCTGGGGCTTACTGGGG + Exonic
1138660645 16:58515243-58515265 CCGAGGGCTGAGGCTTCTTGCGG - Intergenic
1138661934 16:58525559-58525581 CCTTGAGCTTCGGCTTCCTGAGG - Intronic
1138801102 16:60031030-60031052 CCCAGAACTGGGGCTTACCCTGG - Intergenic
1139275500 16:65723956-65723978 CCCAGAGCAGGGGATACCAGGGG + Intergenic
1139469265 16:67169689-67169711 CCCAGCCCTGGGCCTGCCTGGGG + Exonic
1139469537 16:67170732-67170754 CCCAGAGCTTGAGAGTCCTGCGG - Intronic
1139705709 16:68738851-68738873 CCCAGAGATGGTGCTTAATGGGG - Intronic
1139976190 16:70812805-70812827 CCCAGAGGTGGGGATTATTGAGG - Intronic
1141121521 16:81362107-81362129 CTCAGATCTGGGTATTCCTGGGG + Intronic
1141192485 16:81834622-81834644 TTCAGAGCTGGGGCTCCTTGAGG + Intronic
1141766747 16:86064059-86064081 CAGAGAGCAGGGGCTGCCTGAGG - Intergenic
1142034539 16:87855211-87855233 CTCAGAGCTGGGGCGTCCCGGGG + Intronic
1142108709 16:88319659-88319681 CCCACAGACGGGGCTTCCTAGGG - Intergenic
1142123709 16:88399886-88399908 CCCAGGGCTGGGGCCACCTCAGG + Intergenic
1142223295 16:88865614-88865636 CCCAGAGAGGGGGCAGCCTGCGG + Exonic
1142240533 16:88942579-88942601 CCCAGAACGGGGGCTCCGTGAGG + Intronic
1142247068 16:88975056-88975078 CCCTAAGCAGGGGCTCCCTGGGG + Intronic
1142260585 16:89040874-89040896 CTCCGAGCTGTGGGTTCCTGAGG - Intergenic
1142584749 17:965020-965042 CGCAGAGCTTGTACTTCCTGAGG - Intronic
1143030553 17:3964697-3964719 CCGAGAGCTGGGGCGGTCTGCGG + Intergenic
1143036606 17:4003265-4003287 CCTAGCGCCGGGGCTTCATGCGG - Intergenic
1143137437 17:4719744-4719766 CTCAGAGGTGGGGCAGCCTGGGG + Intronic
1143513692 17:7408801-7408823 CTCAGAGCTGGGCCTTTGTGGGG + Intronic
1143633317 17:8150964-8150986 CCCAGGCCTGGGGCTTCCAATGG + Intronic
1143713820 17:8753234-8753256 GGCAGAGAGGGGGCTTCCTGGGG - Intronic
1144761478 17:17709874-17709896 CCAAGAGCTGGTGCTTCAGGAGG + Intronic
1144836582 17:18159529-18159551 CTCAGCCCTGGGGCTTCCTGGGG + Intronic
1144959846 17:19038869-19038891 CCCAGGGCGGGAGTTTCCTGAGG + Intronic
1144975314 17:19135655-19135677 CCCAGGGCGGGAGTTTCCTGAGG - Intronic
1145911764 17:28547257-28547279 CCCAGAACTGGAGCCTCCTGGGG + Exonic
1145960218 17:28882793-28882815 CTCTGAGCTGGGTCTTCCTGGGG + Intronic
1145992152 17:29085747-29085769 GCCAGAGCTGGCTCTTGCTGAGG - Intronic
1147557241 17:41487219-41487241 CCCAGGGCTGTGGGTTTCTGGGG - Intronic
1147931316 17:43983395-43983417 CCCAGAGCTGGGGCTCCATCAGG - Intronic
1147996750 17:44363773-44363795 CGCAGAGCTGGGGCTGCGCGGGG - Exonic
1148438706 17:47700812-47700834 CCCAGTGCTGGGGCCTCCAGGGG + Intronic
1148847122 17:50535947-50535969 CTCTTAGGTGGGGCTTCCTGGGG + Intronic
1149010007 17:51846392-51846414 CCCTGAGCTGGGGCTGCCTATGG + Intronic
1150138439 17:62708909-62708931 TCCCTGGCTGGGGCTTCCTGGGG - Intronic
1150410956 17:64940210-64940232 CCCTGTGCGGGGGCTGCCTGGGG + Intergenic
1151054295 17:71013566-71013588 GCCAGAGCTGGGGGTACCTTTGG - Intergenic
1151758123 17:76086301-76086323 TCCAGGGCTGGTGCTTCCTGCGG - Intronic
1151816416 17:76473585-76473607 CCCCGAGCTGCGGCTTCCTGTGG - Intronic
1151883864 17:76911915-76911937 GGCAGGGCTGGGGCCTCCTGAGG + Intronic
1151892495 17:76958875-76958897 TCCAGGGCTGGGGCCTGCTGAGG + Intergenic
1152008018 17:77694652-77694674 CCCAGAGCAGAGACTGCCTGAGG - Intergenic
1153887407 18:9478875-9478897 CCCAGAGCTGGGGTGTCCTGGGG + Intronic
1154012697 18:10589272-10589294 CCCAGTGCTGGCCGTTCCTGGGG - Intergenic
1154353113 18:13603643-13603665 CACTGAGATGGCGCTTCCTGTGG - Intronic
1155089678 18:22494297-22494319 CCAAGAGCTGTGGCTTCCTGGGG + Intergenic
1155839106 18:30625771-30625793 CACAGAGTTGGGGCTTGGTGGGG + Intergenic
1156449381 18:37258498-37258520 CTCAGCGCTTAGGCTTCCTGAGG + Intronic
1156730963 18:40193104-40193126 CCCAGAGGTGGGGCCTACAGTGG + Intergenic
1156879875 18:42064014-42064036 TCCAGAGGTGGGGCCTTCTGGGG - Intronic
1157210518 18:45738197-45738219 GCCAAAGCTGGGGCTCCCTCTGG + Intronic
1157309817 18:46544090-46544112 CCCAGAGCTGGGACTTATTGGGG - Intronic
1157683658 18:49626331-49626353 CCCAGAGGTGGGGCTGTCTCTGG + Intergenic
1158839389 18:61367807-61367829 GGCAGAGCTGGTTCTTCCTGAGG + Intronic
1159577167 18:70193359-70193381 CCGAGGGCTGCTGCTTCCTGGGG + Exonic
1159970695 18:74648400-74648422 CACAGAGCTGGGCCATGCTGAGG + Intronic
1159998609 18:74993459-74993481 GCCAGAGCTGTGTTTTCCTGGGG + Intronic
1160659730 19:292280-292302 CCCTGAGCTGAGGGTGCCTGGGG + Intergenic
1160662151 19:306197-306219 CCCAGGGCTGGGGCAGCCCGCGG + Exonic
1160785791 19:899756-899778 CCCAGCGCTGTGGGCTCCTGGGG - Intronic
1160793305 19:932848-932870 TTGAGAGCTGGGGGTTCCTGCGG + Intronic
1161054355 19:2182555-2182577 TCCAGGGCTGTGGCTTCCCGGGG + Intronic
1161060053 19:2210356-2210378 GGCAGCGCTGGGGCTTCCTGTGG + Intronic
1161873242 19:6886805-6886827 CCCCCAGCTGGTGCTTTCTGGGG + Intergenic
1162514380 19:11139157-11139179 CCCAGAGCTGGGGCTTGTCTTGG + Intronic
1162761655 19:12892052-12892074 CTTGGGGCTGGGGCTTCCTGTGG + Intronic
1163062335 19:14769518-14769540 CCCTGAGCTGAGGCTTCAAGAGG + Intronic
1164903366 19:31947000-31947022 AACAGAGCTGCTGCTTCCTGAGG + Intergenic
1164978371 19:32593073-32593095 CCCAGAGGTGGAGCCTACTGAGG + Intergenic
1165141445 19:33702630-33702652 CCCAACACTGGGGCTACCTGGGG - Intronic
1165288189 19:34860722-34860744 CCCAGAGGTGGAGCCTACTGAGG - Intergenic
1166049487 19:40249473-40249495 CCCAGCCCTGGGCCATCCTGCGG + Intronic
1166072779 19:40396638-40396660 GCCAGAGGTGCGGCTTCCAGAGG - Exonic
1166218647 19:41352230-41352252 CCCAGAGCTTGGGGGTCCTGAGG - Intronic
1166966647 19:46533241-46533263 CCCAGAGCCCAGGCCTCCTGCGG + Intronic
1167113722 19:47476666-47476688 CCCAGAGTCGGGGCTTCCTGAGG - Exonic
1167116100 19:47489854-47489876 CCTGGGGCTGGGGCTTCCTGAGG + Intronic
1167286860 19:48603375-48603397 GCCAGAGCAGGCGTTTCCTGAGG - Intronic
1167331414 19:48858880-48858902 TCCAGTGCTGGGGACTCCTGGGG + Exonic
1167434342 19:49470407-49470429 CCCAGAGCTGGGGCTGCGAGTGG + Exonic
1168726300 19:58583915-58583937 CCCAGCACTGGGGCTTTCTCTGG + Intergenic
1202713296 1_KI270714v1_random:28804-28826 CCCAGAGCTGGGCCTGCCTTGGG - Intergenic
924977267 2:190031-190053 ACCAGAGCTGGGGCATCTGGTGG + Intergenic
925096444 2:1208135-1208157 CTCAGGGCTGGTGCTTCCCGTGG + Intronic
925150825 2:1613641-1613663 GCCAGAGCTGCGGCTCCTTGAGG + Intergenic
925165850 2:1715196-1715218 CCCGGAGCAGGGTCTTTCTGGGG - Intronic
925983278 2:9194090-9194112 AGCAGAGCTGGGTCCTCCTGTGG + Intergenic
926104945 2:10144173-10144195 CCCAGAGTTGGGGTCCCCTGAGG - Intronic
926723552 2:15980595-15980617 CACAGGGCTGGGACTTCCAGTGG - Intergenic
927116910 2:19913657-19913679 CTCAGTGATTGGGCTTCCTGTGG + Exonic
927148319 2:20181033-20181055 CCCAGAACTTGGGGTCCCTGAGG - Intergenic
927151457 2:20198713-20198735 CCCAGAGCTGGGCCTTGAGGTGG - Intergenic
927289961 2:21395539-21395561 CCCAGAGCTGCCTCTTCCTGGGG - Intergenic
927493264 2:23534643-23534665 CACAGAGCTGGGCCCTGCTGTGG - Intronic
927515296 2:23668696-23668718 CCAAGCTCTGGGGCTCCCTGAGG - Intronic
928612412 2:33003497-33003519 ACCAGTGCTGGGGCATGCTGTGG + Intronic
929170822 2:38931628-38931650 ACCAGAGCTGATGCTGCCTGTGG + Intronic
929504925 2:42521004-42521026 CACATCTCTGGGGCTTCCTGTGG + Intronic
929564444 2:42975658-42975680 CCCCGAGCTGGGGCTTGGGGAGG + Intergenic
929699676 2:44151128-44151150 CACAGGGGTGGGGCTGCCTGAGG + Intergenic
929880488 2:45832683-45832705 CCCAGAGCTCAGGCTGTCTGTGG + Intronic
930740746 2:54830534-54830556 CACACAGCGGGGGCTTCATGAGG - Intronic
930801021 2:55442640-55442662 CCCAGAGGTGGGGCCTACAGAGG - Intergenic
931747148 2:65300351-65300373 CCCAGAGCTGGGAGTCCCCGAGG - Intergenic
932338408 2:70943932-70943954 CCCAGGGCTGGGCCTCCATGGGG - Intronic
932365365 2:71148861-71148883 CTCAGAGCTGAGGCTGCCTCTGG + Intronic
932489929 2:72114134-72114156 CCAGGAGCCGGGGCTTCCTCAGG + Intergenic
933774688 2:85765041-85765063 CCCAGAGCTTTGGCCACCTGGGG - Intronic
934157459 2:89216821-89216843 CATAGAGGTGGGGCTGCCTGAGG - Intergenic
934209861 2:89965922-89965944 CATAGAGGTGGGGCTGCCTGAGG + Intergenic
934331271 2:92072624-92072646 CCCAACGCTGGGGCTTTTTGCGG + Intergenic
934571368 2:95375056-95375078 CCCTCAGCTGGGGTTGCCTGGGG + Intronic
934937861 2:98478254-98478276 CCAAGAGCAGGGCCTGCCTGAGG - Intronic
935617674 2:105102847-105102869 CCATGAGCTCGGGGTTCCTGAGG - Intergenic
936155066 2:110041981-110042003 CCCAGAGCTGGAGCCTGATGAGG + Intergenic
936189616 2:110329433-110329455 CCCAGAGCTGGAGCCTGATGAGG - Intergenic
936427973 2:112435702-112435724 CCCAGGGCCGGGGCTCCCAGAGG - Intergenic
936523224 2:113225691-113225713 CCCAGGGCAAGGGGTTCCTGGGG - Intronic
938092871 2:128444670-128444692 CCCACAGCGGGGGCTTGGTGGGG - Intergenic
938209610 2:129456893-129456915 CCCAGGGCTGGGTCATTCTGTGG - Intergenic
938303298 2:130230997-130231019 CCCGGAGCTGGCGCTGCCTGTGG + Intergenic
938408532 2:131045857-131045879 CCAAGAGCTCAGGCTGCCTGGGG - Intronic
938453374 2:131443240-131443262 CCCGGAGCTGGCGCTGCCTGTGG - Intergenic
939479278 2:142728390-142728412 CCCAGAGGTGGAGCTTACAGAGG - Intergenic
940420803 2:153477898-153477920 CCCAGAGCTTGGCCCACCTGCGG + Exonic
940691603 2:156926152-156926174 CACAGAGATGGGGCTTCCCAAGG - Intergenic
941530317 2:166661997-166662019 GACAGAGCTGGGGCTTTCTTTGG + Intergenic
942399350 2:175584960-175584982 CCTAGAGTTGGGGCCTCTTGAGG - Intergenic
942991988 2:182212937-182212959 CCCAGAGGTGGGGCCTACAGAGG - Intronic
943300525 2:186191874-186191896 CCCAAAGCTGTGTCTCCCTGAGG - Intergenic
943455558 2:188103007-188103029 CCCAGATGGGGTGCTTCCTGGGG + Intergenic
943652443 2:190471643-190471665 CCCAGAGGTGGAGTTTACTGAGG - Intronic
944654398 2:201863559-201863581 CACAGAGCTGGGGCTGGGTGTGG + Intronic
947768236 2:232651118-232651140 CCCAGGGCTGGGGCTCTGTGGGG + Intronic
948392605 2:237623932-237623954 CCCAGAAGTGGGGCTGGCTGAGG - Intergenic
948468399 2:238162942-238162964 CCCAGAGCAGGTGCCTCCTTGGG - Intronic
948545686 2:238727088-238727110 CCCAGAGATGAGGCCTCCAGAGG + Intergenic
948799323 2:240424342-240424364 CTGAGGGCTGGGTCTTCCTGAGG + Intergenic
948877123 2:240835571-240835593 CCCAAAACTGGGTCATCCTGAGG + Intergenic
948900611 2:240955153-240955175 GCCAGAACTGGGTCTTCCTGTGG + Intronic
948909472 2:240995776-240995798 CCGAGTCCTGGGGCATCCTGAGG + Intergenic
948999086 2:241602087-241602109 TGCAGAGTTGGGGCCTCCTGTGG - Intronic
1169183225 20:3589740-3589762 ACCAGAGCTGGAGTGTCCTGAGG - Intronic
1171045898 20:21809280-21809302 GCGGGAGCTGGGGCTTCCTGGGG + Intergenic
1172119482 20:32589410-32589432 CCCAGGCCTGGAACTTCCTGTGG - Intronic
1172274623 20:33672993-33673015 TTCAGGGCTGGGGCTTCCTATGG + Intronic
1172353190 20:34260020-34260042 CCCAGGCCTGGGGTCTCCTGGGG + Intronic
1173318908 20:41970000-41970022 CCCAGGGAAGGGGCTGCCTGTGG + Intergenic
1174081493 20:47973460-47973482 CCCTGGGCCGGGGCTTCCTGTGG + Intergenic
1174135005 20:48373426-48373448 CCCTGGGCCGGGGCTTCCTGTGG - Intergenic
1174449494 20:50610617-50610639 CCCTGAGGTGGGACTCCCTGAGG - Intronic
1175008563 20:55711193-55711215 GCCAGAGGTGTGGGTTCCTGTGG - Intergenic
1175021962 20:55860097-55860119 CCCAGAGGTGGGGCCTACAGAGG - Intergenic
1175215905 20:57391607-57391629 CCCCGAGCGCGGGCTTCCCGCGG + Exonic
1175368416 20:58470878-58470900 TCCAGAACTGGGGCACCCTGGGG - Intronic
1175403032 20:58711323-58711345 CCCTGTGCTGAGGCCTCCTGTGG - Intronic
1175820852 20:61908035-61908057 CCCAGAGCTGGGCCGGGCTGCGG + Intronic
1176139621 20:63539276-63539298 GGCAGCGCGGGGGCTTCCTGGGG - Intergenic
1176147978 20:63573959-63573981 CACAGCGCTGGGTCTTGCTGCGG + Intronic
1176230207 20:64028667-64028689 CGCAGGGCTGGCACTTCCTGAGG + Intronic
1176374282 21:6079510-6079532 CCCAGGGCCGGGGCTCCCAGAGG + Intergenic
1176422344 21:6526363-6526385 CCCTGAGCTGAGGCTGCCAGGGG + Intergenic
1177025782 21:15920178-15920200 CCCAGAGGTGGTGCCTACTGAGG + Intergenic
1177273555 21:18877828-18877850 CCCTGAGATGGGGCTCCCAGGGG - Intergenic
1178390893 21:32197302-32197324 CCCAGAGCTGTAGCTGTCTGAGG + Intergenic
1179084125 21:38202703-38202725 CCTAGGGATGTGGCTTCCTGAGG + Intronic
1179569336 21:42268916-42268938 CTCAGTGCTGGGGCTCACTGGGG - Intronic
1179697835 21:43134679-43134701 CCCTGAGCTGAGGCTGCCAGGGG + Intergenic
1179749194 21:43458735-43458757 CCCAGGGCCGGGGCTCCCAGAGG - Intergenic
1180045252 21:45302169-45302191 CCCAGGGCTGGCGGTTGCTGAGG + Intergenic
1181463669 22:23099429-23099451 CACCCAGCTGGGGCTTCCTCAGG + Intronic
1181670938 22:24425179-24425201 CCCAGGGCTGGGGCACCCTGGGG - Intronic
1183336088 22:37247432-37247454 CCCAGAGCTGGGTATTCAGGTGG - Intergenic
1183708053 22:39487153-39487175 CTCAGTGCTGGGGCTTTCAGGGG + Intronic
1183934616 22:41255152-41255174 CCCACACCTGTAGCTTCCTGAGG - Intronic
1184066320 22:42123814-42123836 CCCAGCCCTGGGCCTTCCAGGGG - Intergenic
1184068788 22:42135966-42135988 CCCAGCCCTGGGCCTTCCAGGGG - Intergenic
1184112349 22:42402664-42402686 CCCAGAGCAGGCGCTCCCTGCGG - Intronic
1184249321 22:43251194-43251216 CCCACAGCTGGGGCAGCCAGCGG + Intronic
1184531956 22:45061881-45061903 CCCGGAGCTGGGGAATCCTGTGG + Intergenic
1184757251 22:46524035-46524057 CACAGAGCTGGAGGTTTCTGAGG - Intronic
1185134107 22:49058962-49058984 CCCAGACCTGGGGCCTCCCAGGG + Intergenic
1185184611 22:49391548-49391570 GCCGGAGCTGGGGCTGCGTGAGG - Intergenic
1185414273 22:50701181-50701203 CCCAGAGCCGGTGCCTGCTGTGG + Intergenic
950712116 3:14820202-14820224 ACCAAAGCTGGGGCTGCGTGCGG + Exonic
950808184 3:15626443-15626465 TCCAGAGGTGGGGCTCCCTGAGG - Intronic
952183548 3:30944277-30944299 CTCAGAGTTGTTGCTTCCTGAGG - Intergenic
952886794 3:38017263-38017285 CCCAGGGCTGGGGCTAACTGAGG - Intronic
953073122 3:39543546-39543568 CACAGAGCAGGCACTTCCTGAGG + Intergenic
953897353 3:46812457-46812479 CCCAGAGCGGCAGCTCCCTGGGG - Exonic
953922128 3:46959593-46959615 GCAAGGGCTGGGGCTTCCTCCGG - Intronic
954139411 3:48597164-48597186 GCCAGAGCTGGGGCTTCAGAGGG - Intergenic
954156360 3:48686860-48686882 TCCTGGGCTCGGGCTTCCTGTGG - Intergenic
954662900 3:52235430-52235452 CCCAGAGCTCGGCCATCCTGCGG - Intronic
954862978 3:53705592-53705614 CCAGGTGCTGGGGTTTCCTGTGG + Intronic
956723430 3:72138014-72138036 CCGAGGGCTGGGGCTTTGTGGGG - Intergenic
960988348 3:123294983-123295005 CCCTGGGCTGGGGCACCCTGGGG - Intronic
961110054 3:124276334-124276356 CCCAGTGACGGGGCATCCTGGGG - Intronic
961548124 3:127650392-127650414 CCCAGGCCTGGGGCTTCATCAGG + Intronic
961577963 3:127854009-127854031 CTCAGGGCTTGGTCTTCCTGGGG - Intergenic
961603656 3:128078102-128078124 TCCAGAGCAGGGCCTTCTTGGGG + Intronic
961656075 3:128442555-128442577 CCCAGAGCTTGGGATCCCTCAGG + Intergenic
962235384 3:133702227-133702249 CCCAGAGCTGGAGGGGCCTGTGG - Intergenic
963050703 3:141140921-141140943 CCCAGAGGTGGAGCCTCCAGAGG + Intronic
963119236 3:141762586-141762608 CCCAGAGCTGGAGCCTACGGAGG + Intergenic
964015996 3:151947479-151947501 CCCAGTACTTTGGCTTCCTGTGG + Intergenic
965523329 3:169690530-169690552 CCCTGAGCTGGTGCTTCTTGTGG - Intergenic
965717749 3:171625398-171625420 CCCAGAGGTGGGGCCTACAGAGG - Intronic
965788697 3:172364327-172364349 CCCAGACCTGTGGCTTCCATTGG + Intronic
966042589 3:175509769-175509791 CGCAGAGCTGGGGAGTCCTCAGG + Intronic
966115273 3:176453757-176453779 CCCAGAGGTGGAGCCTACTGAGG + Intergenic
967361490 3:188636576-188636598 CCCAGAGCTGGAGCCTACAGAGG - Intronic
967876430 3:194271179-194271201 CCAGGACCTGGGGCTCCCTGGGG - Intergenic
968086405 3:195875880-195875902 TCCAGAGCTGGGGCAGCCTTAGG - Intronic
968519957 4:1030749-1030771 GCCAAGGCTGGGGCTCCCTGTGG + Intergenic
968606021 4:1536152-1536174 CCCAGAGCGGGGGCTCCCCAGGG + Intergenic
968635406 4:1675872-1675894 CCCAGAGCTGGAGCTCCACGGGG + Intronic
968972531 4:3803474-3803496 CCCCATGTTGGGGCTTCCTGTGG + Intergenic
969320826 4:6411439-6411461 CACGGAGCAGGGGCTTCCTAGGG - Intronic
969415114 4:7052942-7052964 CCCACAGCTGGGGCTTCCTCTGG - Intronic
969629622 4:8328771-8328793 CACAGTGCTGGGGAGTCCTGGGG - Intergenic
969814215 4:9674677-9674699 CCCAGAGCTGGGGACTGCAGAGG - Intergenic
970095831 4:12461837-12461859 CCCAGAGTTGGGGCCTACAGAGG - Intergenic
970182850 4:13417284-13417306 CCCAGAGGTGGGGTTTACAGAGG - Intronic
971116060 4:23647216-23647238 CCCAGAGGTGGGGCCTACAGAGG + Intergenic
973600363 4:52536752-52536774 CCCAGAGCTGGTGCTCTCTGGGG + Intergenic
973719281 4:53706873-53706895 CCCAGAGCCAAGGCTACCTGTGG - Intronic
974956333 4:68645829-68645851 CCCAGAGGTGGGGCCTTCAGAGG + Intronic
976223556 4:82777730-82777752 CCCAACCATGGGGCTTCCTGTGG + Intronic
976524900 4:86075865-86075887 CCCAGAGGTGGGGCCTACAGTGG + Intronic
976529468 4:86135206-86135228 CCCAGAGGTGGAGCCTCCAGAGG - Intronic
976905196 4:90228143-90228165 CCCAGAGGTGGAGCCTCCAGAGG - Intronic
979592214 4:122493446-122493468 CCCAGAGGTGGAGCCTACTGAGG - Intergenic
979839889 4:125424443-125424465 CCCAGAGCTGGGGAGGCCTCAGG - Intronic
980685362 4:136220272-136220294 CCCAGTGATGGTGCTTCCTGGGG - Intergenic
981005584 4:139871686-139871708 CCCTGAGCTGTGTCTTCCTCAGG + Intronic
981376782 4:144025118-144025140 CCTAGGGATGTGGCTTCCTGAGG - Intergenic
981387284 4:144146464-144146486 CCCAGGGATGTGGCTTCCTGAGG - Intergenic
981445841 4:144837242-144837264 CCCAGAGGTGGGGTTTACAGAGG - Intergenic
981958068 4:150503102-150503124 CCCAGAGGTGGAGCCTCCAGAGG - Intronic
982878878 4:160685856-160685878 CCCAGCAAGGGGGCTTCCTGGGG + Intergenic
983453152 4:167931417-167931439 CACAGGGTTGGGGCTGCCTGAGG + Intergenic
983799022 4:171903664-171903686 CCCAGAGGTGGAGCCTCCAGAGG - Intronic
984063478 4:175020273-175020295 CCCAGAGGTGGAGCTTACAGAGG - Intergenic
984857693 4:184208760-184208782 CCCAGAGGTGGAGCTTACAGAGG - Intronic
984947843 4:184983673-184983695 CCCAGAGCTGTGGCTCCCATGGG + Intergenic
985119679 4:186627558-186627580 CCCAGAGCTGGGGCCTGCTGGGG - Intronic
985561828 5:591798-591820 TCTAGCGATGGGGCTTCCTGAGG + Intergenic
985782367 5:1878027-1878049 CCTGCAGCTGGGGCGTCCTGGGG + Exonic
985992583 5:3575572-3575594 CCCTGAGCTGAGGCGTCCTCTGG + Intergenic
986112535 5:4734066-4734088 CCCACAACTGGCACTTCCTGTGG + Intergenic
986274085 5:6258282-6258304 TCCAGAGCTGGGATTCCCTGGGG - Intergenic
986359854 5:6966809-6966831 CCCAGAGCTGGAGCCTACAGAGG - Intergenic
986569680 5:9152196-9152218 CACAGGCCTGCGGCTTCCTGTGG + Intronic
987737487 5:21865808-21865830 GCCATAGCTGGGGCTGTCTGGGG - Intronic
987934979 5:24451797-24451819 CCCAAACATGGGGCTTCCTGTGG + Intergenic
988085515 5:26470393-26470415 ACCAGAGGTGGGGATTCATGTGG - Intergenic
989148513 5:38273248-38273270 CCCAGTGCTGGGTTTTACTGTGG - Intronic
991942289 5:71864346-71864368 ACCAGAGCTGGAGATTACTGGGG + Intergenic
992189034 5:74272617-74272639 ACCAGAGATGGGGTTTCCAGCGG + Intergenic
993195404 5:84736491-84736513 CCCAGAGAAAGGGCTACCTGAGG - Intergenic
994347295 5:98701428-98701450 TCTAGGGATGGGGCTTCCTGAGG - Intergenic
996693903 5:126371537-126371559 CACCGAGCTGGGGCTGTCTGTGG - Intronic
996915192 5:128703566-128703588 CATAGAGGTGGGGCTGCCTGAGG + Intronic
997080499 5:130732627-130732649 CCCAGAGGTGGGGCCTACAGTGG - Intergenic
997461440 5:134055188-134055210 CCCACCCCTGTGGCTTCCTGGGG - Intergenic
997496142 5:134327892-134327914 CCCAAAGCTGTGCCTCCCTGAGG + Intronic
998426986 5:142037074-142037096 CGCCGACCTCGGGCTTCCTGAGG + Intergenic
999088032 5:148910776-148910798 CCCTGACCTGGTGGTTCCTGAGG + Intergenic
999203523 5:149832863-149832885 CCCAGAGCTAGGGAGTCCCGGGG - Exonic
1001438478 5:171719501-171719523 CTCTGGGCTGGGGCTTTCTGAGG + Intergenic
1001952171 5:175823976-175823998 CACAGGCCTGGGGCTTGCTGGGG + Intronic
1002348535 5:178565326-178565348 CCTGGAGCTGGGCCTCCCTGAGG - Intronic
1002540396 5:179902781-179902803 GCCAGAGGAGGGGCTTCCTGTGG - Intronic
1002798268 6:494613-494635 CTCAGAACAGTGGCTTCCTGTGG - Intronic
1003043302 6:2709507-2709529 CTCAGTCCTGGGGCTTGCTGTGG - Intronic
1005331118 6:24751576-24751598 TGGAGAGCTGTGGCTTCCTGTGG + Intergenic
1005734431 6:28732364-28732386 CCGAGAGCCACGGCTTCCTGTGG + Intergenic
1005923186 6:30418434-30418456 CCCAGGGCTGCTGCTTGCTGAGG - Intergenic
1006642293 6:35495714-35495736 CCCAGTGCTGGGGCCACCTGGGG - Intronic
1006936710 6:37723676-37723698 TACCGACCTGGGGCTTCCTGAGG - Intergenic
1006936736 6:37723809-37723831 ACCAGACCAAGGGCTTCCTGAGG - Intergenic
1007250806 6:40493607-40493629 GACAGAGCTGGGGCTTCTGGAGG - Intronic
1007470723 6:42088585-42088607 CCCAGAGCTGGGGCCTGCTCAGG - Intergenic
1007694163 6:43721327-43721349 CCCAGAGCTGGGTGGTCCAGGGG + Intergenic
1007929059 6:45674849-45674871 CCCAGAGGTGGGGCCTACAGTGG + Intergenic
1007980226 6:46147278-46147300 TCCAGACCTTGTGCTTCCTGAGG + Intergenic
1008483637 6:52011992-52012014 CTCAGAGCTGCAGCTTTCTGAGG + Intronic
1008769521 6:54961956-54961978 CCCAGAGGTGGAGCTTACAGAGG - Intergenic
1009325642 6:62345399-62345421 CCCTGAGATGGAGCTTCCAGGGG + Intergenic
1009946503 6:70347325-70347347 CCCAGAGGAGGGGCTCCCAGAGG - Intergenic
1010047686 6:71466221-71466243 CCCACATTTGGGGATTCCTGTGG + Intergenic
1010263299 6:73840881-73840903 CCCAGAGGTGGAGCTTACAGAGG + Intergenic
1011018208 6:82782092-82782114 CACAGGGATGGGGCTTCCTAAGG + Intergenic
1012561449 6:100586179-100586201 CCCAGAGGTGGGGCCTACAGAGG + Intronic
1012719416 6:102722638-102722660 CCCAGAGGTGGGGCCTACAGAGG - Intergenic
1014154221 6:118092651-118092673 CACAGAGGTGGAGCTTCCCGAGG + Intronic
1014841789 6:126228119-126228141 CCCAGAGCTGGGCCTCACAGAGG - Intergenic
1016175958 6:141077829-141077851 CCCTTAGATGGGGCTTGCTGTGG - Intergenic
1016309214 6:142715213-142715235 CCAAGTGATGGGGCTTCCTTGGG - Intergenic
1016826168 6:148390335-148390357 CCCAGTGCTAGCTCTTCCTGGGG + Intronic
1017442364 6:154475675-154475697 CCCAGCCCTAGGCCTTCCTGGGG + Intronic
1017817737 6:158027662-158027684 CCCAGGGGAGGGGCTTCCTTGGG - Intronic
1018177112 6:161186682-161186704 CCTGGAGTTGGGGCTTGCTGGGG - Intronic
1018430579 6:163718512-163718534 CCCAAATCTGGGGCTACATGTGG + Intergenic
1018776578 6:167022918-167022940 ACCAGAGCATGAGCTTCCTGAGG - Intronic
1018848526 6:167571713-167571735 ACCAGAGCTGGGTCCTCCAGGGG + Intergenic
1018868802 6:167765869-167765891 CCCTGAGCAGAAGCTTCCTGAGG - Intergenic
1018869416 6:167769929-167769951 CCCAGAGCTCGGTCTTCCCATGG + Intergenic
1018941386 6:168310548-168310570 CCCTGAGCTGAGGCTACCGGAGG + Intronic
1018964555 6:168474314-168474336 AGCTGGGCTGGGGCTTCCTGGGG + Intronic
1019016586 6:168884851-168884873 CCAAGGGCCGGGGCTGCCTGGGG + Intergenic
1019058352 6:169238779-169238801 CCCAGAGCTGTGTCATCCTCAGG - Intronic
1019073738 6:169370383-169370405 CACAGCTCTGGGGGTTCCTGTGG - Intergenic
1020013842 7:4820076-4820098 CCCTGAGCTGACTCTTCCTGTGG + Intronic
1020392049 7:7668858-7668880 TCCAGAGCTGGTTCCTCCTGAGG - Intronic
1022523871 7:31024863-31024885 CCCAGAACCGAGGCTTGCTGGGG + Intergenic
1022628128 7:32059407-32059429 GCCCCAGGTGGGGCTTCCTGTGG - Intronic
1023083862 7:36550580-36550602 TCCTGAGCTCTGGCTTCCTGTGG + Intronic
1023090763 7:36615502-36615524 CCTGCAGTTGGGGCTTCCTGTGG - Intronic
1023213354 7:37832368-37832390 ATCACAGCTGAGGCTTCCTGGGG + Intronic
1023461626 7:40404162-40404184 CCCAGAAGTGGAGTTTCCTGAGG - Intronic
1023664686 7:42510577-42510599 CTGAGAGCTAGGGCTGCCTGTGG + Intergenic
1023755853 7:43416500-43416522 CCCAGAGGTGGGGCCTACAGTGG + Intronic
1023872513 7:44270366-44270388 CTCAGGGCTGGGGCTACCTGGGG + Intronic
1024461717 7:49666282-49666304 CCCAGAGGTGGGGCCTACAGAGG - Intergenic
1024563440 7:50663217-50663239 CCCAGGGAGGGGGCTGCCTGGGG - Intronic
1025032266 7:55567605-55567627 CCCAGACCTGGGGCTTTCCTTGG - Intronic
1025955170 7:66177201-66177223 CCCAGAGCTGGACATTGCTGTGG + Intergenic
1027222130 7:76220779-76220801 CCCAAGGCTGGGGCTGGCTGGGG - Intronic
1027739784 7:81986431-81986453 CCCAAAACTGGGGCTACGTGAGG - Intronic
1029128710 7:98313492-98313514 CCCAGAGTGAGGGCATCCTGTGG - Intronic
1029441638 7:100590066-100590088 CCCAGAGCTGGTGAGTCCTTGGG + Exonic
1029538388 7:101169027-101169049 CCCAGAGCTGGGGAATCCTGGGG + Intergenic
1031113552 7:117641662-117641684 CACAGAGTTGGGGCTCTCTGTGG + Intronic
1032202452 7:129831768-129831790 CCCGGTGCTGGGGCTTCCAGAGG + Exonic
1032442473 7:131952580-131952602 CCCAAAGCAGGGACTGCCTGAGG + Intergenic
1032512379 7:132482126-132482148 CCCAGAGGTGGGGATCACTGGGG - Intronic
1033361847 7:140643556-140643578 CCCATTGCTGGGTCATCCTGTGG + Intronic
1033565126 7:142570576-142570598 CCCAGGGATGGAGCTTCCAGAGG + Intergenic
1034528542 7:151681347-151681369 TCCAGAGCTGGTGACTCCTGTGG + Intronic
1034528619 7:151681855-151681877 CCCAGAAGTGGGGCTTCACGGGG + Intronic
1034886747 7:154804140-154804162 TCCAGAGCTGCGGCGTCCTGAGG + Intronic
1034963634 7:155377993-155378015 CGCGGGGCTGGGGCTTCCGGGGG - Intergenic
1035052061 7:156004724-156004746 CGCAGAGCTGGGCCTGCTTGGGG + Intergenic
1035287999 7:157818588-157818610 CCCCCAGCTGGTGCCTCCTGTGG + Intronic
1035314715 7:157990707-157990729 TCAGGAGCTGGGGCTGCCTGGGG + Intronic
1035333694 7:158112587-158112609 CTCCCAGCTGGGCCTTCCTGGGG - Intronic
1035520966 8:274707-274729 CCAAGAGCTGGAGCTCACTGAGG + Intergenic
1036115186 8:5951677-5951699 CCCTGAACTGAAGCTTCCTGAGG - Intergenic
1036484895 8:9170780-9170802 CCCAGGGCCAGAGCTTCCTGTGG - Intergenic
1036600934 8:10259685-10259707 CCCAGGACTAGGGTTTCCTGGGG + Intronic
1036797693 8:11768321-11768343 CCTATAGCAGGGGCATCCTGGGG + Intergenic
1036810072 8:11861905-11861927 CCCAGAGCTAGGCCTTTCTGTGG - Intronic
1037359087 8:18054211-18054233 CCCACAGCCCGGGCTTCCTCTGG - Intergenic
1037535296 8:19817737-19817759 CCCAGAGCTGCGCCTGCCTGGGG + Intronic
1038416124 8:27397314-27397336 CCCAGACTTGGGGCTCCCAGGGG - Intronic
1038767546 8:30442878-30442900 GCCTGAACTGGGGCTTCCGGGGG + Intronic
1039794999 8:40905423-40905445 CCCAGAACTGCAGCTTCCAGTGG + Intergenic
1041338250 8:56812168-56812190 CCCAGAGGTGGAGCCTACTGAGG + Intergenic
1041409093 8:57533866-57533888 CCAAGGGCTCGGGGTTCCTGGGG + Intergenic
1041690232 8:60679910-60679932 CCCGGAGTTGGGGGCTCCTGGGG + Intronic
1041694303 8:60719653-60719675 CCCAGTGCTGGAGCTCCCTGAGG - Intronic
1041809130 8:61887684-61887706 CCCAGTGCTGGGTTTTACTGGGG + Intergenic
1043377594 8:79667909-79667931 TCCAGAGCTTTGGATTCCTGAGG + Intergenic
1043515608 8:80992163-80992185 CGCAGGGCCGGGGCTTCCCGGGG - Intronic
1045511493 8:102815369-102815391 GCCAGAGCTGGGGATTTTTGGGG + Intergenic
1045851208 8:106700423-106700445 CATACAGCTGGGGCTTTCTGCGG - Intronic
1046445014 8:114306821-114306843 CAGAGAGTTGGGGCTTCCTTTGG + Intergenic
1046517896 8:115287039-115287061 TCCTGAGCTGGGTTTTCCTGTGG - Intergenic
1048121249 8:131583919-131583941 CACATAGCTGGGGATTCCTCAGG + Intergenic
1048371121 8:133777017-133777039 CACAGAGCTGGAGCTGTCTGTGG + Intergenic
1048613653 8:136051030-136051052 CCCACAGCTGGGGGTGCCTCAGG - Intergenic
1048998210 8:139807160-139807182 CAGAGAGCTGGGGCTGTCTGTGG + Intronic
1048998522 8:139809547-139809569 CCCACAGCAGGGCCTTTCTGTGG + Intronic
1049176420 8:141195367-141195389 CCCGGGGCTGGCGCATCCTGAGG + Exonic
1049180896 8:141221647-141221669 CCCTGAGCTGGGGCCGCCGGCGG - Exonic
1049598419 8:143495465-143495487 CTCAGAGCTGGGGCTGCCTCTGG + Intronic
1049678304 8:143903270-143903292 CCCAGGGGTGTGGCTTCCTCGGG + Intergenic
1049758130 8:144319859-144319881 CCCGGAGCTCGGGCCTCATGCGG + Intronic
1049808938 8:144554568-144554590 ACCAGCCTTGGGGCTTCCTGTGG - Intronic
1050101435 9:2124006-2124028 CCTAGAGCTGGGATTTTCTGAGG + Intronic
1051727526 9:20103242-20103264 CCCAGAGGTGGAGCTTACAGAGG - Intergenic
1051778067 9:20658249-20658271 CCCAGAGGTGGAGCTTACAGAGG + Intergenic
1052995567 9:34550154-34550176 CCCAGAGGTGGGGCCTGGTGAGG - Intergenic
1053477480 9:38392836-38392858 CCAGGAGCTGCGGCTTCCCGAGG - Intronic
1053945900 9:43310688-43310710 CCCAACGCTGGGGCTTTTTGCGG + Intergenic
1055102987 9:72484311-72484333 GCCAGAGCTTCTGCTTCCTGTGG - Intergenic
1056776498 9:89516653-89516675 TCCAGTGCTTGGGGTTCCTGTGG - Intergenic
1056953205 9:91062219-91062241 CTCTGTGCTGGAGCTTCCTGTGG - Intergenic
1057306300 9:93914087-93914109 CCCCGAGGTGGGGCTCACTGTGG - Intergenic
1058889115 9:109345626-109345648 CCCAGGACTGTGGCTCCCTGAGG + Intergenic
1059331797 9:113540243-113540265 CTCAGAGCTGGGCCCACCTGTGG + Intronic
1060012480 9:120055770-120055792 CCCAGAGGTGGGGCCTACAGAGG - Intergenic
1060047436 9:120351801-120351823 CCCAGGGATGGGGCTGCTTGAGG + Intergenic
1060184755 9:121557614-121557636 CCCAGAGCTTGGCCTTGGTGAGG - Intergenic
1060279645 9:122207132-122207154 CTCAGAGCTGTCCCTTCCTGTGG - Intronic
1060965888 9:127712136-127712158 CCCAGGACTGGGGCCACCTGGGG - Intronic
1061081206 9:128371422-128371444 CACAGAGCTGGGGCGCCGTGGGG + Intronic
1061169872 9:128946445-128946467 GCCAGAGCAGGGGATTCCTGCGG + Exonic
1061266969 9:129511760-129511782 CCTAGAGCTGAGACATCCTGAGG - Intergenic
1061619371 9:131801618-131801640 GGCAGAGCAGGGGCTTTCTGGGG + Intergenic
1061724115 9:132572195-132572217 CAGAGAGCAGGGGCTACCTGGGG - Intronic
1061780974 9:132995911-132995933 CCCAGGGCCAGGGCCTCCTGAGG + Intergenic
1061893871 9:133636859-133636881 CCCCGAGCTTGGGCATCATGGGG + Intronic
1061908034 9:133708743-133708765 TCCAGTGCTGGGGAGTCCTGGGG + Intronic
1061974322 9:134060811-134060833 GCCAGAGGTGGGCCTGCCTGGGG - Intronic
1062012212 9:134273275-134273297 ACCAAAGCTCAGGCTTCCTGGGG - Intergenic
1062066066 9:134527030-134527052 CCCACAGCGGGGGCTCCCTGAGG - Intergenic
1062213605 9:135377568-135377590 CCCTGAGATGAGGCGTCCTGTGG + Intergenic
1062282374 9:135757777-135757799 CTCAGAGCAGGGCCTGCCTGTGG - Intronic
1062550615 9:137084614-137084636 CCCAGGGCTGGAGCTCACTGGGG + Intergenic
1062718878 9:138024412-138024434 CCCTGGGCTGGGGCCTCCAGCGG - Intronic
1203589035 Un_KI270747v1:39268-39290 CCCAACGCTGGGGCTTTTTGCGG + Intergenic
1185587249 X:1249149-1249171 CCCAGAGCAAGGGCTTGGTGGGG - Intergenic
1191028052 X:55936924-55936946 CCCAGAGGTGGAGCTTACAGAGG - Intergenic
1191136163 X:57067516-57067538 GCCAGAATTGGGGCTTCTTGGGG + Intergenic
1193017854 X:76756110-76756132 CCCAGAGCTGGAGCCTACAGAGG - Intergenic
1193449623 X:81649706-81649728 CATAGGGATGGGGCTTCCTGAGG + Intergenic
1193738271 X:85186114-85186136 CCCAGAGCTGGGGCTTGAAATGG + Intergenic
1196126685 X:112108930-112108952 CCCAGTGCTGGGTTTTACTGTGG + Intergenic
1196669120 X:118346718-118346740 CCCAGACCTGGGGCTTCTTAGGG + Intronic
1197254559 X:124249084-124249106 CCCAGTGCCAGGGCTTCCTAAGG + Intronic
1197463482 X:126772098-126772120 CCTAGGGATGTGGCTTCCTGAGG - Intergenic
1197676682 X:129337575-129337597 CCCAGAGGTGGAGCCTACTGAGG - Intergenic
1202055562 Y:20826465-20826487 CCCAGAGCTGGAGCCTACAGAGG + Intergenic